EMAIL THIS PAGE TO A FRIEND

COL5A3

collagen, type V, alpha 3

79 Gene Product Result for
UniProtKB ID: P25940, Q9NZQ6
Gene ID:
Human(50509) Summary: This gene encodes an alpha chain for one of the low abundance fibrillar collagens. Fibrillar collagen molecules are trimers that can be composed of one or more types of alpha chains. Type V collagen is found in tissues containing type I collagen and appears to regulate the assembly of heterotypic fibers composed of both type I and type V collagen. This gene product is closely related to type XI collagen and it is possible that the collagen chains of types V and XI constitute a single collagen type with tissue-specific chain combinations. Mutations in this gene are thought to be responsible for the symptoms of a subset of patients with Ehlers-Danlos syndrome type III. Messages of several sizes can be detected in northern blots but sequence information cannot confirm the identity of the shorter messages. [provided by RefSeq, Jul 2008]
Mouse(53867) collagen, type V, alpha 3
Rat(60379) collagen, type V, alpha 3
Zebrafish(553362) collagen, type V, alpha 3
dog(484961) collagen, type V, alpha 3
domestic cat(101088143) collagen, type V, alpha 3
cow(507881) collagen, type V, alpha 3
sheep(101115457) collagen, type V, alpha 3
naked mole-rat(101709825) collagen, type V, alpha 3
domestic guinea pig(100716296) collagen, type V, alpha 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015719 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015719 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015719 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016919 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016919 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016919 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU035281 MISSION® esiRNA esiRNA human COL5A3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015719 Rosetta Predictions human pricing
NM_021760 Rosetta Predictions rat pricing
NM_016919 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015719 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348405 predicted 5362
2 SASI_Hs01_00102631 predicted 669
3 SASI_Hs01_00102632 predicted 5377
4 SASI_Hs01_00102633 predicted 4958
5 SASI_Hs01_00102634 predicted 2836
6 SASI_Hs01_00102635 predicted 5250
7 SASI_Hs02_00348406 predicted 5208
8 SASI_Hs01_00102637 predicted 2984
9 SASI_Hs01_00102638 predicted 1020
10 SASI_Hs01_00102639 predicted 378
11 SASI_Hs01_00102630 predicted 352
12 SASI_Hs01_00102636 predicted 891
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021760 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073086 predicted 1167
2 SASI_Rn01_00073087 predicted 1743
3 SASI_Rn01_00073088 predicted 1367
4 SASI_Rn01_00073089 predicted 5307
5 SASI_Rn01_00073090 predicted 373
6 SASI_Rn01_00073091 predicted 756
7 SASI_Rn01_00073092 predicted 369
8 SASI_Rn01_00073093 predicted 360
9 SASI_Rn02_00262820 predicted 4927
10 SASI_Rn01_00073094 predicted 3461
11 SASI_Rn01_00073095 predicted 4787
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016919 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323782 predicted 5174
2 SASI_Mm01_00168308 predicted 1392
3 SASI_Mm01_00168309 predicted 5120
4 SASI_Mm01_00168310 predicted 5089
5 SASI_Mm01_00168311 predicted 3897
6 SASI_Mm01_00168312 predicted 267
7 SASI_Mm01_00168313 predicted 245
8 SASI_Mm01_00168314 predicted 401
9 SASI_Mm01_00168315 predicted 1775
10 SASI_Mm01_00168317 predicted 2083
11 SASI_Mm01_00168316 predicted 2754
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015719
COL5A3 MISSION shRNA Bacterial Glycerol Stock
collagen, type V, alpha 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015719.3-670s21c1
Sequence:CCGGAGACTTTCGAGGGAGACATTCCTCGAGGAATGTCTCCCTCGAAAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422530    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015719.3-5385s21c1
Sequence:CCGGGGCTTTGAAGCCACCGTATTTCTCGAGAAATACGGTGGCTTCAAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117047    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015719.2-5788s1c1
Sequence:CCGGCCTTTCTACTTCCACGGTGAACTCGAGTTCACCGTGGAAGTAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015719.2-2480s1c1
Sequence:CCGGCCCTGGACCTAAGGGATCTATCTCGAGATAGATCCCTTAGGTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015719.2-3054s1c1
Sequence:CCGGCCTACTGGCTTAAAGGGTGATCTCGAGATCACCCTTTAAGCCAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015719.2-4298s1c1
Sequence:CCGGCATTGGATTGATCGGTCTCATCTCGAGATGAGACCGATCAATCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015719.2-2481s1c1
Sequence:CCGGCCTGGACCTAAGGGATCTATTCTCGAGAATAGATCCCTTAGGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015719
COL5A3 MISSION shRNA shRNA Plasmid DNA
collagen, type V, alpha 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015719.3-670s21c1
Sequence:CCGGAGACTTTCGAGGGAGACATTCCTCGAGGAATGTCTCCCTCGAAAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422530    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015719.3-5385s21c1
Sequence:CCGGGGCTTTGAAGCCACCGTATTTCTCGAGAAATACGGTGGCTTCAAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117047    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015719.2-5788s1c1
Sequence:CCGGCCTTTCTACTTCCACGGTGAACTCGAGTTCACCGTGGAAGTAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015719.2-2480s1c1
Sequence:CCGGCCCTGGACCTAAGGGATCTATCTCGAGATAGATCCCTTAGGTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015719.2-3054s1c1
Sequence:CCGGCCTACTGGCTTAAAGGGTGATCTCGAGATCACCCTTTAAGCCAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015719.2-4298s1c1
Sequence:CCGGCATTGGATTGATCGGTCTCATCTCGAGATGAGACCGATCAATCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015719.2-2481s1c1
Sequence:CCGGCCTGGACCTAAGGGATCTATTCTCGAGAATAGATCCCTTAGGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015719
COL5A3 MISSION shRNA Lentiviral Transduction Particles
collagen, type V, alpha 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015719.3-670s21c1
Sequence:CCGGAGACTTTCGAGGGAGACATTCCTCGAGGAATGTCTCCCTCGAAAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422530    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015719.3-5385s21c1
Sequence:CCGGGGCTTTGAAGCCACCGTATTTCTCGAGAAATACGGTGGCTTCAAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117047    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015719.2-5788s1c1
Sequence:CCGGCCTTTCTACTTCCACGGTGAACTCGAGTTCACCGTGGAAGTAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015719.2-2480s1c1
Sequence:CCGGCCCTGGACCTAAGGGATCTATCTCGAGATAGATCCCTTAGGTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015719.2-3054s1c1
Sequence:CCGGCCTACTGGCTTAAAGGGTGATCTCGAGATCACCCTTTAAGCCAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015719.2-4298s1c1
Sequence:CCGGCATTGGATTGATCGGTCTCATCTCGAGATGAGACCGATCAATCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015719.2-2481s1c1
Sequence:CCGGCCTGGACCTAAGGGATCTATTCTCGAGAATAGATCCCTTAGGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016919
VALIDATED
COL5A3 MISSION shRNA Bacterial Glycerol Stock
collagen, type V, alpha 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000335313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016919.2-749s21c1
Sequence:CCGGCTGGTTGTGAAACCCTCGATTCTCGAGAATCGAGGGTTTCACAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335316    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016919.2-5890s21c1
Sequence:CCGGGCTCATAACTGGGAACTGTATCTCGAGATACAGTTCCCAGTTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016919.2-3490s21c1
Sequence:CCGGCGAGGCTTTGTAGGTGTAATTCTCGAGAATTACACCTACAAAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016919.2-2473s21c1
Sequence:CCGGCCAGGACCTAAGGGATCTATTCTCGAGAATAGATCCCTTAGGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016919.1-5890s1c1
Sequence:CCGGGCTCATAACTGGGAACTGTATCTCGAGATACAGTTCCCAGTTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016919.1-4995s1c1
Sequence:CCGGCCATCAGAGGTTCACTTACATCTCGAGATGTAAGTGAACCTCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016919.1-749s1c1
Sequence:CCGGCTGGTTGTGAAACCCTCGATTCTCGAGAATCGAGGGTTTCACAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016919.1-2473s1c1
Sequence:CCGGCCAGGACCTAAGGGATCTATTCTCGAGAATAGATCCCTTAGGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016919.1-3490s1c1
Sequence:CCGGCGAGGCTTTGTAGGTGTAATTCTCGAGAATTACACCTACAAAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016919
VALIDATED
COL5A3 MISSION shRNA shRNA Plasmid DNA
collagen, type V, alpha 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000335313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016919.2-749s21c1
Sequence:CCGGCTGGTTGTGAAACCCTCGATTCTCGAGAATCGAGGGTTTCACAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335316    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016919.2-5890s21c1
Sequence:CCGGGCTCATAACTGGGAACTGTATCTCGAGATACAGTTCCCAGTTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016919.2-3490s21c1
Sequence:CCGGCGAGGCTTTGTAGGTGTAATTCTCGAGAATTACACCTACAAAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016919.2-2473s21c1
Sequence:CCGGCCAGGACCTAAGGGATCTATTCTCGAGAATAGATCCCTTAGGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016919.1-5890s1c1
Sequence:CCGGGCTCATAACTGGGAACTGTATCTCGAGATACAGTTCCCAGTTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016919.1-4995s1c1
Sequence:CCGGCCATCAGAGGTTCACTTACATCTCGAGATGTAAGTGAACCTCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016919.1-749s1c1
Sequence:CCGGCTGGTTGTGAAACCCTCGATTCTCGAGAATCGAGGGTTTCACAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016919.1-2473s1c1
Sequence:CCGGCCAGGACCTAAGGGATCTATTCTCGAGAATAGATCCCTTAGGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016919.1-3490s1c1
Sequence:CCGGCGAGGCTTTGTAGGTGTAATTCTCGAGAATTACACCTACAAAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016919
VALIDATED
COL5A3 MISSION shRNA Lentiviral Transduction Particles
collagen, type V, alpha 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000335313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016919.2-749s21c1
Sequence:CCGGCTGGTTGTGAAACCCTCGATTCTCGAGAATCGAGGGTTTCACAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335316    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016919.2-5890s21c1
Sequence:CCGGGCTCATAACTGGGAACTGTATCTCGAGATACAGTTCCCAGTTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016919.2-3490s21c1
Sequence:CCGGCGAGGCTTTGTAGGTGTAATTCTCGAGAATTACACCTACAAAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016919.2-2473s21c1
Sequence:CCGGCCAGGACCTAAGGGATCTATTCTCGAGAATAGATCCCTTAGGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016919.1-5890s1c1
Sequence:CCGGGCTCATAACTGGGAACTGTATCTCGAGATACAGTTCCCAGTTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016919.1-4995s1c1
Sequence:CCGGCCATCAGAGGTTCACTTACATCTCGAGATGTAAGTGAACCTCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016919.1-749s1c1
Sequence:CCGGCTGGTTGTGAAACCCTCGATTCTCGAGAATCGAGGGTTTCACAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016919.1-2473s1c1
Sequence:CCGGCCAGGACCTAAGGGATCTATTCTCGAGAATAGATCCCTTAGGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016919.1-3490s1c1
Sequence:CCGGCGAGGCTTTGTAGGTGTAATTCTCGAGAATTACACCTACAAAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks