EMAIL THIS PAGE TO A FRIEND

COL6A1

collagen, type VI, alpha 1

60 Gene Product Result for
Synonyms: OPLL
Gene ID:
Human(1291) Summary: The collagens are a superfamily of proteins that play a role in maintaining the integrity of various tissues. Collagens are extracellular matrix proteins and have a triple-helical domain as their common structural element. Collagen VI is a major structural component of microfibrils. The basic structural unit of collagen VI is a heterotrimer of the alpha1(VI), alpha2(VI), and alpha3(VI) chains. The alpha2(VI) and alpha3(VI) chains are encoded by the COL6A2 and COL6A3 genes, respectively. The protein encoded by this gene is the alpha 1 subunit of type VI collagen (alpha1(VI) chain). Mutations in the genes that code for the collagen VI subunits result in the autosomal dominant disorder, Bethlem myopathy. [provided by RefSeq, Jul 2008]
Mouse(12833) collagen, type VI, alpha 1
Rat(294337) collagen, type VI, alpha 1
Zebrafish(569755) collagen, type VI, alpha 1
chicken(396000) collagen, type VI, alpha 1
cow(511422) collagen, type VI, alpha 1
Horse(100050035) collagen, type VI, alpha 1
domestic cat(101081156) collagen, type VI, alpha 1
dog(403668) collagen, type VI, alpha 1
domestic guinea pig(100732346) collagen, type VI, alpha 1
naked mole-rat(101710889) collagen, type VI, alpha 1
sheep(443051) collagen, type VI, alpha 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001848 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001848 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001848 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009933 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009933 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009933 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001848 Rosetta Predictions human pricing
XM_001079629 Rosetta Predictions rat pricing
XM_215375 Rosetta Predictions rat pricing
NM_009933 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001848 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014661 predicted 326
2 SASI_Hs01_00014662 predicted 2391
3 SASI_Hs01_00014663 predicted 3074
4 SASI_Hs01_00014664 predicted 1970
5 SASI_Hs01_00014665 predicted 633
6 SASI_Hs01_00014666 predicted 377
7 SASI_Hs01_00014667 predicted 2803
8 SASI_Hs01_00014669 predicted 2534
9 SASI_Hs01_00014670 predicted 799
10 SASI_Hs02_00332662 predicted 2808
11 SASI_Hs01_00014668 predicted 833
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079629 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00364911 predicted 2538
2 SASI_Rn02_00364912 predicted 3086
3 SASI_Rn02_00364913 predicted 2255
4 SASI_Rn02_00364914 predicted 795
5 SASI_Rn02_00364915 predicted 2519
6 SASI_Rn02_00364916 predicted 2982
7 SASI_Rn02_00364917 predicted 383
8 SASI_Rn02_00364918 predicted 781
9 SASI_Rn02_00364919 predicted 3245
10 SASI_Rn02_00364920 predicted 3031
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215375 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375925 predicted 2536
2 SASI_Rn02_00375926 predicted 3085
3 SASI_Rn02_00375927 predicted 2258
4 SASI_Rn02_00375928 predicted 788
5 SASI_Rn02_00375929 predicted 2520
6 SASI_Rn02_00375930 predicted 2986
7 SASI_Rn02_00375931 predicted 385
8 SASI_Rn02_00375932 predicted 781
9 SASI_Rn02_00375933 predicted 3244
10 SASI_Rn02_00375934 predicted 3035
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009933 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044407 predicted 2465
2 SASI_Mm02_00317481 predicted 753
3 SASI_Mm01_00044399 predicted 2474
4 SASI_Mm01_00044400 predicted 2027
5 SASI_Mm01_00044401 predicted 3290
6 SASI_Mm01_00044402 predicted 723
7 SASI_Mm01_00044403 predicted 410
8 SASI_Mm01_00044404 predicted 1957
9 SASI_Mm01_00044405 predicted 2551
10 SASI_Mm01_00044406 predicted 811
11 SASI_Mm01_00044408 predicted 748
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001848
VALIDATED
COL6A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type VI, alpha 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116957    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001848.1-3995s1c1
Sequence:CCGGGCTGTGTCTTACTAGAAACAACTCGAGTTGTTTCTAGTAAGACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001848.1-2357s1c1
Sequence:CCGGGTGGGCATCAAAGACGTGTTTCTCGAGAAACACGTCTTTGATGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001848.1-1194s1c1
Sequence:CCGGCCTTTGGACTGAAAGGAGAAACTCGAGTTTCTCCTTTCAGTCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001848.1-277s1c1
Sequence:CCGGCAAAGTCAAGTCCTTCACCAACTCGAGTTGGTGAAGGACTTGACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001848.1-1762s1c1
Sequence:CCGGCGGAGACGATAACAACGACATCTCGAGATGTCGTTGTTATCGTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001848.2-1982s21c1
Sequence:CCGGGCCTGCAGAACTTCGAGATTGCTCGAGCAATCTCGAAGTTCTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001848.2-1199s21c1
Sequence:CCGGCCTTTGGACTGAAAGGAGAAACTCGAGTTTCTCCTTTCAGTCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001848.2-2810s21c1
Sequence:CCGGCCGTCGATGCCATGGACTTTACTCGAGTAAAGTCCATGGCATCGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001848.2-2362s21c1
Sequence:CCGGGTGGGCATCAAAGACGTGTTTCTCGAGAAACACGTCTTTGATGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300353    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001848.2-4055s21c1
Sequence:CCGGGCTGTGTCTTACTAGAAACAACTCGAGTTGTTTCTAGTAAGACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001848
VALIDATED
COL6A1 MISSION shRNA shRNA Plasmid DNA
collagen, type VI, alpha 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116957    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001848.1-3995s1c1
Sequence:CCGGGCTGTGTCTTACTAGAAACAACTCGAGTTGTTTCTAGTAAGACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001848.1-2357s1c1
Sequence:CCGGGTGGGCATCAAAGACGTGTTTCTCGAGAAACACGTCTTTGATGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001848.1-1194s1c1
Sequence:CCGGCCTTTGGACTGAAAGGAGAAACTCGAGTTTCTCCTTTCAGTCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001848.1-277s1c1
Sequence:CCGGCAAAGTCAAGTCCTTCACCAACTCGAGTTGGTGAAGGACTTGACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001848.1-1762s1c1
Sequence:CCGGCGGAGACGATAACAACGACATCTCGAGATGTCGTTGTTATCGTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001848.2-1982s21c1
Sequence:CCGGGCCTGCAGAACTTCGAGATTGCTCGAGCAATCTCGAAGTTCTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001848.2-1199s21c1
Sequence:CCGGCCTTTGGACTGAAAGGAGAAACTCGAGTTTCTCCTTTCAGTCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001848.2-2810s21c1
Sequence:CCGGCCGTCGATGCCATGGACTTTACTCGAGTAAAGTCCATGGCATCGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001848.2-2362s21c1
Sequence:CCGGGTGGGCATCAAAGACGTGTTTCTCGAGAAACACGTCTTTGATGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300353    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001848.2-4055s21c1
Sequence:CCGGGCTGTGTCTTACTAGAAACAACTCGAGTTGTTTCTAGTAAGACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001848
VALIDATED
COL6A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type VI, alpha 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116957    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001848.1-3995s1c1
Sequence:CCGGGCTGTGTCTTACTAGAAACAACTCGAGTTGTTTCTAGTAAGACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001848.1-2357s1c1
Sequence:CCGGGTGGGCATCAAAGACGTGTTTCTCGAGAAACACGTCTTTGATGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001848.1-1194s1c1
Sequence:CCGGCCTTTGGACTGAAAGGAGAAACTCGAGTTTCTCCTTTCAGTCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001848.1-277s1c1
Sequence:CCGGCAAAGTCAAGTCCTTCACCAACTCGAGTTGGTGAAGGACTTGACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001848.1-1762s1c1
Sequence:CCGGCGGAGACGATAACAACGACATCTCGAGATGTCGTTGTTATCGTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001848.2-1982s21c1
Sequence:CCGGGCCTGCAGAACTTCGAGATTGCTCGAGCAATCTCGAAGTTCTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001848.2-1199s21c1
Sequence:CCGGCCTTTGGACTGAAAGGAGAAACTCGAGTTTCTCCTTTCAGTCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001848.2-2810s21c1
Sequence:CCGGCCGTCGATGCCATGGACTTTACTCGAGTAAAGTCCATGGCATCGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001848.2-2362s21c1
Sequence:CCGGGTGGGCATCAAAGACGTGTTTCTCGAGAAACACGTCTTTGATGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300353    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001848.2-4055s21c1
Sequence:CCGGGCTGTGTCTTACTAGAAACAACTCGAGTTGTTTCTAGTAAGACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009933
VALIDATED
COL6A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type VI, alpha 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009933.1-3348s1c1
Sequence:CCGGGCACACTCTTTGCTTTGTGTACTCGAGTACACAAAGCAAAGAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009933.1-3125s1c1
Sequence:CCGGCCACCTATTCCGTGTACCAAACTCGAGTTTGGTACACGGAATAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009933.1-825s1c1
Sequence:CCGGGACACCATTGTGGACATGATTCTCGAGAATCATGTCCACAATGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009933.1-1173s1c1
Sequence:CCGGCCAGGATTTGATGGCATTCAACTCGAGTTGAATGCCATCAAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009933.1-2277s1c1
Sequence:CCGGCCCACACAGAACAACCGAATTCTCGAGAATTCGGTTGTTCTGTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009933
VALIDATED
COL6A1 MISSION shRNA shRNA Plasmid DNA
collagen, type VI, alpha 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009933.1-3348s1c1
Sequence:CCGGGCACACTCTTTGCTTTGTGTACTCGAGTACACAAAGCAAAGAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009933.1-3125s1c1
Sequence:CCGGCCACCTATTCCGTGTACCAAACTCGAGTTTGGTACACGGAATAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009933.1-825s1c1
Sequence:CCGGGACACCATTGTGGACATGATTCTCGAGAATCATGTCCACAATGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009933.1-1173s1c1
Sequence:CCGGCCAGGATTTGATGGCATTCAACTCGAGTTGAATGCCATCAAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009933.1-2277s1c1
Sequence:CCGGCCCACACAGAACAACCGAATTCTCGAGAATTCGGTTGTTCTGTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009933
VALIDATED
COL6A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type VI, alpha 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009933.1-3348s1c1
Sequence:CCGGGCACACTCTTTGCTTTGTGTACTCGAGTACACAAAGCAAAGAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009933.1-3125s1c1
Sequence:CCGGCCACCTATTCCGTGTACCAAACTCGAGTTTGGTACACGGAATAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009933.1-825s1c1
Sequence:CCGGGACACCATTGTGGACATGATTCTCGAGAATCATGTCCACAATGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009933.1-1173s1c1
Sequence:CCGGCCAGGATTTGATGGCATTCAACTCGAGTTGAATGCCATCAAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009933.1-2277s1c1
Sequence:CCGGCCCACACAGAACAACCGAATTCTCGAGAATTCGGTTGTTCTGTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks