EMAIL THIS PAGE TO A FRIEND

COL6A2

collagen, type VI, alpha 2

147 Gene Product Result for
Synonyms: PP3610
Gene ID:
Human(1292) Summary: This gene encodes one of the three alpha chains of type VI collagen, a beaded filament collagen found in most connective tissues. The product of this gene contains several domains similar to von Willebrand Factor type A domains. These domains have been shown to bind extracellular matrix proteins, an interaction that explains the importance of this collagen in organizing matrix components. Mutations in this gene are associated with Bethlem myopathy and Ullrich scleroatonic muscular dystrophy. Three transcript variants have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(12834) collagen, type VI, alpha 2
Rat(361821) collagen, type VI, alpha 2
sheep(101106490) collagen, type VI, alpha 2
naked mole-rat(101711621) collagen, type VI, alpha 2
domestic guinea pig(100732068) collagen, type VI, alpha 2
Zebrafish(567771) collagen, type VI, alpha 2
cow(282194) collagen, type VI, alpha 2
Horse(100055332) collagen, type VI, alpha 2
domestic cat(101100658) collagen, type VI, alpha 2
dog(100688584) collagen, type VI, alpha 2
chicken(396292) collagen, type VI, alpha 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001849 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001849 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001849 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146007 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146007 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146007 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001849 Rosetta Predictions human pricing
NM_058174 Rosetta Predictions human pricing
NM_058175 Rosetta Predictions human pricing
XM_001079642 Rosetta Predictions rat pricing
XM_342115 Rosetta Predictions rat pricing
NM_146007 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001849 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332663 predicted 268
2 SASI_Hs01_00065131 predicted 384
3 SASI_Hs02_00332664 predicted 2206
4 SASI_Hs02_00332665 predicted 2118
5 SASI_Hs02_00332666 predicted 2194
6 SASI_Hs01_00065132 predicted 1949
7 SASI_Hs01_00065133 predicted 291
8 SASI_Hs01_00065135 predicted 1731
9 SASI_Hs01_00065136 predicted 523
10 SASI_Hs02_00332667 predicted 2143
11 SASI_Hs01_00065130 predicted 266
12 SASI_Hs01_00065134 predicted 750
13 SASI_Hs01_00065137 predicted 1689
14 SASI_Hs01_00065138 predicted 589
15 SASI_Hs01_00065139 predicted 389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_058174 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362075 predicted 267
2 SASI_Hs01_00093059 predicted 385
3 SASI_Hs02_00362076 predicted 2206
4 SASI_Hs02_00362077 predicted 2113
5 SASI_Hs02_00362078 predicted 2194
6 SASI_Hs01_00093060 predicted 1950
7 SASI_Hs01_00093061 predicted 288
8 SASI_Hs01_00093063 predicted 1731
9 SASI_Hs01_00093064 predicted 526
10 SASI_Hs02_00362079 predicted 2146
11 SASI_Hs01_00093058 predicted 268
12 SASI_Hs01_00093062 predicted 751
13 SASI_Hs01_00093065 predicted 1698
14 SASI_Hs01_00093066 predicted 589
15 SASI_Hs01_00093067 predicted 395
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_058175 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362080 predicted 268
2 SASI_Hs01_00230950 predicted 385
3 SASI_Hs02_00362081 predicted 2203
4 SASI_Hs02_00362082 predicted 2115
5 SASI_Hs02_00362083 predicted 2198
6 SASI_Hs01_00230951 predicted 1942
7 SASI_Hs01_00230952 predicted 287
8 SASI_Hs01_00230954 predicted 1737
9 SASI_Hs01_00230955 predicted 527
10 SASI_Hs02_00362084 predicted 2148
11 SASI_Hs01_00230949 predicted 266
12 SASI_Hs01_00230953 predicted 759
13 SASI_Hs01_00230956 predicted 1691
14 SASI_Hs01_00230957 predicted 586
15 SASI_Hs01_00230958 predicted 390
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079642 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00364945 predicted 795
2 SASI_Rn02_00364946 predicted 230
3 SASI_Rn02_00364947 predicted 2786
4 SASI_Rn02_00364948 predicted 2228
5 SASI_Rn02_00364949 predicted 2560
6 SASI_Rn02_00364950 predicted 2136
7 SASI_Rn02_00364951 predicted 1113
8 SASI_Rn02_00364952 predicted 837
9 SASI_Rn02_00364953 predicted 1479
10 SASI_Rn02_00364954 predicted 2309
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342115 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393774 predicted 800
2 SASI_Rn02_00393775 predicted 225
3 SASI_Rn02_00393776 predicted 2784
4 SASI_Rn02_00393777 predicted 2225
5 SASI_Rn02_00393778 predicted 2559
6 SASI_Rn02_00393779 predicted 2142
7 SASI_Rn02_00393780 predicted 1107
8 SASI_Rn02_00393781 predicted 837
9 SASI_Rn02_00393782 predicted 1478
10 SASI_Rn02_00393783 predicted 2314
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146007 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035393 predicted 904
2 SASI_Mm01_00035394 predicted 903
3 SASI_Mm02_00341549 predicted 2094
4 SASI_Mm01_00035395 predicted 2895
5 SASI_Mm01_00035396 predicted 529
6 SASI_Mm01_00035397 predicted 2671
7 SASI_Mm01_00035398 predicted 2508
8 SASI_Mm01_00035399 predicted 2677
9 SASI_Mm01_00035400 predicted 2244
10 SASI_Mm01_00035401 predicted 921
11 SASI_Mm01_00035402 predicted 2340
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001849
COL6A2 MISSION shRNA Bacterial Glycerol Stock
collagen, type VI, alpha 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001849.3-2430s21c1
Sequence:CCGGTGCGCAACATGACGCTGTTCTCTCGAGAGAACAGCGTCATGTTGCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001849.3-1848s21c1
Sequence:CCGGTCACGGAGTGTGACGTCATGACTCGAGTCATGACGTCACACTCCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001849.2-770s1c1
Sequence:CCGGCGCATCATCAAGGTCATGAAACTCGAGTTTCATGACCTTGATGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001849.2-3097s1c1
Sequence:CCGGCGGCTTCTTCGACCGCTTCATCTCGAGATGAAGCGGTCGAAGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001849.2-2452s1c1
Sequence:CCGGCGCTGAGAAGTTCATCGATGACTCGAGTCATCGATGAACTTCTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001849.2-154s1c1
Sequence:CCGGGCCGGACACTACCGAGAGAAACTCGAGTTTCTCTCGGTAGTGTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001849.2-1981s1c1
Sequence:CCGGCTTCGTCATCAACGTGGTCAACTCGAGTTGACCACGTTGATGACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001849
COL6A2 MISSION shRNA shRNA Plasmid DNA
collagen, type VI, alpha 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001849.3-2430s21c1
Sequence:CCGGTGCGCAACATGACGCTGTTCTCTCGAGAGAACAGCGTCATGTTGCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001849.3-1848s21c1
Sequence:CCGGTCACGGAGTGTGACGTCATGACTCGAGTCATGACGTCACACTCCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001849.2-770s1c1
Sequence:CCGGCGCATCATCAAGGTCATGAAACTCGAGTTTCATGACCTTGATGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001849.2-3097s1c1
Sequence:CCGGCGGCTTCTTCGACCGCTTCATCTCGAGATGAAGCGGTCGAAGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001849.2-2452s1c1
Sequence:CCGGCGCTGAGAAGTTCATCGATGACTCGAGTCATCGATGAACTTCTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001849.2-154s1c1
Sequence:CCGGGCCGGACACTACCGAGAGAAACTCGAGTTTCTCTCGGTAGTGTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001849.2-1981s1c1
Sequence:CCGGCTTCGTCATCAACGTGGTCAACTCGAGTTGACCACGTTGATGACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001849
COL6A2 MISSION shRNA Lentiviral Transduction Particles
collagen, type VI, alpha 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001849.3-2430s21c1
Sequence:CCGGTGCGCAACATGACGCTGTTCTCTCGAGAGAACAGCGTCATGTTGCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001849.3-1848s21c1
Sequence:CCGGTCACGGAGTGTGACGTCATGACTCGAGTCATGACGTCACACTCCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001849.2-770s1c1
Sequence:CCGGCGCATCATCAAGGTCATGAAACTCGAGTTTCATGACCTTGATGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001849.2-3097s1c1
Sequence:CCGGCGGCTTCTTCGACCGCTTCATCTCGAGATGAAGCGGTCGAAGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001849.2-2452s1c1
Sequence:CCGGCGCTGAGAAGTTCATCGATGACTCGAGTCATCGATGAACTTCTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001849.2-154s1c1
Sequence:CCGGGCCGGACACTACCGAGAGAAACTCGAGTTTCTCTCGGTAGTGTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001849.2-1981s1c1
Sequence:CCGGCTTCGTCATCAACGTGGTCAACTCGAGTTGACCACGTTGATGACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146007
COL6A2 MISSION shRNA Bacterial Glycerol Stock
collagen, type VI, alpha 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146007.1-3258s1c1
Sequence:CCGGCGGTACACTTGGGTCTTTCTACTCGAGTAGAAAGACCCAAGTGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146007.1-2844s1c1
Sequence:CCGGGCCACCTACCTCAATTCCTTTCTCGAGAAAGGAATTGAGGTAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146007.1-1092s1c1
Sequence:CCGGGCTGGCAAGAATGGAACAGATCTCGAGATCTGTTCCATTCTTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146007.1-3005s1c1
Sequence:CCGGGCACTCTATGCGTAAGCAGAACTCGAGTTCTGCTTACGCATAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146007.1-335s1c1
Sequence:CCGGGCAGTTCGTACCGCAGTTTATCTCGAGATAAACTGCGGTACGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146007
COL6A2 MISSION shRNA shRNA Plasmid DNA
collagen, type VI, alpha 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146007.1-3258s1c1
Sequence:CCGGCGGTACACTTGGGTCTTTCTACTCGAGTAGAAAGACCCAAGTGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146007.1-2844s1c1
Sequence:CCGGGCCACCTACCTCAATTCCTTTCTCGAGAAAGGAATTGAGGTAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146007.1-1092s1c1
Sequence:CCGGGCTGGCAAGAATGGAACAGATCTCGAGATCTGTTCCATTCTTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146007.1-3005s1c1
Sequence:CCGGGCACTCTATGCGTAAGCAGAACTCGAGTTCTGCTTACGCATAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146007.1-335s1c1
Sequence:CCGGGCAGTTCGTACCGCAGTTTATCTCGAGATAAACTGCGGTACGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146007
COL6A2 MISSION shRNA Lentiviral Transduction Particles
collagen, type VI, alpha 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146007.1-3258s1c1
Sequence:CCGGCGGTACACTTGGGTCTTTCTACTCGAGTAGAAAGACCCAAGTGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146007.1-2844s1c1
Sequence:CCGGGCCACCTACCTCAATTCCTTTCTCGAGAAAGGAATTGAGGTAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146007.1-1092s1c1
Sequence:CCGGGCTGGCAAGAATGGAACAGATCTCGAGATCTGTTCCATTCTTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146007.1-3005s1c1
Sequence:CCGGGCACTCTATGCGTAAGCAGAACTCGAGTTCTGCTTACGCATAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146007.1-335s1c1
Sequence:CCGGGCAGTTCGTACCGCAGTTTATCTCGAGATAAACTGCGGTACGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks