EMAIL THIS PAGE TO A FRIEND

COL6A3

collagen, type VI, alpha 3

182 Gene Product Result for
Gene ID:
Human(1293) Summary: This gene encodes the alpha-3 chain, one of the three alpha chains of type VI collagen, a beaded filament collagen found in most connective tissues. The alpha-3 chain of type VI collagen is much larger than the alpha-1 and -2 chains. This difference in size is largely due to an increase in the number of subdomains, similar to von Willebrand Factor type A domains, that are found in the amino terminal globular domain of all the alpha chains. These domains have been shown to bind extracellular matrix proteins, an interaction that explains the importance of this collagen in organizing matrix components. Mutations in the type VI collagen genes are associated with Bethlem myopathy, a rare autosomal dominant proximal myopathy with early childhood onset. Mutations in this gene are also a cause of Ullrich congenital muscular dystrophy, also referred to as Ullrich scleroatonic muscular dystrophy, an autosomal recessive congenital myopathy that is more severe than Bethlem myopathy. Multiple transcript variants have been identified, but the full-length nature of only some of these variants has been described. [provided by RefSeq, Jun 2009]
Mouse(12835) collagen, type VI, alpha 3
Rat(367313) collagen, type VI, alpha 3
Zebrafish(556874) collagen, type VI, alpha 3
cow(530657) collagen, type VI, alpha 3
domestic cat(101081323) collagen, type VI, alpha 3
dog(403582) collagen, type VI, alpha 3
chicken(396548) collagen, type VI, alpha 3
domestic guinea pig(100716662) collagen, type VI, alpha 3
naked mole-rat(101717072) collagen, type VI, alpha 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA010080 Anti-COL6A3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB4500389 Anti-Collagen VI α3 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004369 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004369 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004369 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_484897 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_484897 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_484897 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004369 Rosetta Predictions human pricing
NM_057164 Rosetta Predictions human pricing
NM_057165 Rosetta Predictions human pricing
NM_057166 Rosetta Predictions human pricing
NM_057167 Rosetta Predictions human pricing
NM_001109008 Rosetta Predictions rat pricing
XM_897036 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004369 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104507 predicted 6231
2 SASI_Hs02_00337440 predicted 6265
3 SASI_Hs01_00104508 predicted 6143
4 SASI_Hs01_00104509 predicted 5349
5 SASI_Hs01_00104510 predicted 9859
6 SASI_Hs01_00104511 predicted 5947
7 SASI_Hs01_00104513 predicted 8591
8 SASI_Hs01_00104515 predicted 8400
9 SASI_Hs01_00104516 predicted 9524
10 SASI_Hs02_00337441 predicted 8412
11 SASI_Hs01_00104512 predicted 8326
12 SASI_Hs01_00104514 predicted 8795
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057164 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105365 predicted 5728
2 SASI_Hs02_00362021 predicted 5767
3 SASI_Hs01_00105366 predicted 5642
4 SASI_Hs01_00105367 predicted 4852
5 SASI_Hs01_00105368 predicted 9365
6 SASI_Hs01_00105369 predicted 5450
7 SASI_Hs01_00105371 predicted 8092
8 SASI_Hs01_00105373 predicted 7899
9 SASI_Hs01_00105374 predicted 9016
10 SASI_Hs02_00362022 predicted 7907
11 SASI_Hs01_00105370 predicted 7825
12 SASI_Hs01_00105372 predicted 8299
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057165 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240476 predicted 5631
2 SASI_Hs02_00362023 predicted 5669
3 SASI_Hs01_00240477 predicted 5546
4 SASI_Hs01_00240478 predicted 4749
5 SASI_Hs01_00240479 predicted 9266
6 SASI_Hs01_00240480 predicted 5344
7 SASI_Hs01_00240482 predicted 7994
8 SASI_Hs01_00240484 predicted 7806
9 SASI_Hs01_00240485 predicted 8919
10 SASI_Hs02_00362024 predicted 7813
11 SASI_Hs01_00240481 predicted 7728
12 SASI_Hs01_00240483 predicted 8200
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057166 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031539 predicted 5627
2 SASI_Hs02_00362025 predicted 5663
3 SASI_Hs01_00031540 predicted 5546
4 SASI_Hs01_00031541 predicted 4749
5 SASI_Hs01_00031542 predicted 9262
6 SASI_Hs01_00031543 predicted 5349
7 SASI_Hs01_00031545 predicted 7995
8 SASI_Hs01_00031547 predicted 7799
9 SASI_Hs01_00031548 predicted 8917
10 SASI_Hs02_00362026 predicted 7813
11 SASI_Hs01_00031544 predicted 7725
12 SASI_Hs01_00031546 predicted 8192
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057167 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070193 predicted 5610
2 SASI_Hs02_00362027 predicted 5654
3 SASI_Hs01_00070194 predicted 5529
4 SASI_Hs01_00070195 predicted 4730
5 SASI_Hs01_00070196 predicted 9249
6 SASI_Hs01_00070197 predicted 5330
7 SASI_Hs01_00070199 predicted 7982
8 SASI_Hs01_00070201 predicted 7782
9 SASI_Hs01_00070202 predicted 8903
10 SASI_Hs02_00362028 predicted 7792
11 SASI_Hs01_00070198 predicted 7709
12 SASI_Hs01_00070200 predicted 8174
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109008 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244264 predicted 830
2 SASI_Rn02_00244265 predicted 1281
3 SASI_Rn02_00244266 predicted 1395
4 SASI_Rn02_00244267 predicted 1864
5 SASI_Rn02_00244268 predicted 1725
6 SASI_Rn02_00244269 predicted 4547
7 SASI_Rn02_00244270 predicted 1306
8 SASI_Rn02_00244271 predicted 1648
9 SASI_Rn02_00244272 predicted 1437
10 SASI_Rn02_00244273 predicted 6073
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897036 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00222455 predicted 10306
2 SASI_Mm01_00222456 predicted 10208
3 SASI_Mm01_00222457 predicted 10504
4 SASI_Mm01_00222458 predicted 10578
5 SASI_Mm01_00222459 predicted 10435
6 SASI_Mm01_00222460 predicted 10554
7 SASI_Mm01_00222461 predicted 10540
8 SASI_Mm01_00222462 predicted 10466
9 SASI_Mm01_00222463 predicted 10406
10 SASI_Mm01_00222464 predicted 10566
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004369
COL6A3 MISSION shRNA Bacterial Glycerol Stock
collagen, type VI, alpha 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004369.x-4607s1c1
Sequence:CCGGGCTTTGCACATATTCGAGATTCTCGAGAATCTCGAATATGTGCAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004369.x-7387s1c1
Sequence:CCGGGCCCTCATCCAAAGCATCAAACTCGAGTTTGATGCTTTGGATGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004369.x-2230s1c1
Sequence:CCGGCGCGACTTTGTAATGAACCTACTCGAGTAGGTTCATTACAAAGTCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004369.x-9214s1c1
Sequence:CCGGGTGGTTAAGATGCTCCGTGAACTCGAGTTCACGGAGCATCTTAACCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003625    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004369.x-10343s1c1
Sequence:CCGGCCTTAATCTATGTGCACCGTTCTCGAGAACGGTGCACATAGATTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004369
COL6A3 MISSION shRNA shRNA Plasmid DNA
collagen, type VI, alpha 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004369.x-4607s1c1
Sequence:CCGGGCTTTGCACATATTCGAGATTCTCGAGAATCTCGAATATGTGCAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004369.x-7387s1c1
Sequence:CCGGGCCCTCATCCAAAGCATCAAACTCGAGTTTGATGCTTTGGATGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004369.x-2230s1c1
Sequence:CCGGCGCGACTTTGTAATGAACCTACTCGAGTAGGTTCATTACAAAGTCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004369.x-9214s1c1
Sequence:CCGGGTGGTTAAGATGCTCCGTGAACTCGAGTTCACGGAGCATCTTAACCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003625    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004369.x-10343s1c1
Sequence:CCGGCCTTAATCTATGTGCACCGTTCTCGAGAACGGTGCACATAGATTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004369
COL6A3 MISSION shRNA Lentiviral Transduction Particles
collagen, type VI, alpha 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004369.x-4607s1c1
Sequence:CCGGGCTTTGCACATATTCGAGATTCTCGAGAATCTCGAATATGTGCAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004369.x-7387s1c1
Sequence:CCGGGCCCTCATCCAAAGCATCAAACTCGAGTTTGATGCTTTGGATGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004369.x-2230s1c1
Sequence:CCGGCGCGACTTTGTAATGAACCTACTCGAGTAGGTTCATTACAAAGTCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004369.x-9214s1c1
Sequence:CCGGGTGGTTAAGATGCTCCGTGAACTCGAGTTCACGGAGCATCTTAACCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003625    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004369.x-10343s1c1
Sequence:CCGGCCTTAATCTATGTGCACCGTTCTCGAGAACGGTGCACATAGATTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_484897
COL6A3 MISSION shRNA Bacterial Glycerol Stock
collagen, type VI, alpha 3
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000091854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484897.2-423s1c1
Sequence:CCGGCCCTCAGGTTATCATAGTATTCTCGAGAATACTATGATAACCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484897.2-5182s1c1
Sequence:CCGGGCCATCAACAAAGTCGTCTATCTCGAGATAGACGACTTTGTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484897.2-9468s1c1
Sequence:CCGGCCAAGGAAGTTTCAATACGAACTCGAGTTCGTATTGAAACTTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484897.2-303s1c1
Sequence:CCGGCCTTTCTCATATTGTGAACATCTCGAGATGTTCACAATATGAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_484897
COL6A3 MISSION shRNA shRNA Plasmid DNA
collagen, type VI, alpha 3
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000091854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484897.2-423s1c1
Sequence:CCGGCCCTCAGGTTATCATAGTATTCTCGAGAATACTATGATAACCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484897.2-5182s1c1
Sequence:CCGGGCCATCAACAAAGTCGTCTATCTCGAGATAGACGACTTTGTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484897.2-9468s1c1
Sequence:CCGGCCAAGGAAGTTTCAATACGAACTCGAGTTCGTATTGAAACTTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484897.2-303s1c1
Sequence:CCGGCCTTTCTCATATTGTGAACATCTCGAGATGTTCACAATATGAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_484897
COL6A3 MISSION shRNA Lentiviral Transduction Particles
collagen, type VI, alpha 3
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000091854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484897.2-423s1c1
Sequence:CCGGCCCTCAGGTTATCATAGTATTCTCGAGAATACTATGATAACCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484897.2-5182s1c1
Sequence:CCGGGCCATCAACAAAGTCGTCTATCTCGAGATAGACGACTTTGTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484897.2-9468s1c1
Sequence:CCGGCCAAGGAAGTTTCAATACGAACTCGAGTTCGTATTGAAACTTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484897.2-303s1c1
Sequence:CCGGCCTTTCTCATATTGTGAACATCTCGAGATGTTCACAATATGAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks