EMAIL THIS PAGE TO A FRIEND

COL6A5

collagen, type VI, alpha 5

120 Gene Product Result for
Synonyms: COL29A1 VWA4
Gene ID:
Human(256076) Summary: This gene encodes a member of the collagen superfamily of proteins. The encoded protein contains multiple von Willebrand factor A-like domains and may interact with the alpha 1 and alpha 2 chains of collagen VI to form the complete collagen VI trimer. Polymorphisms in this gene may be linked to dermal phenotypes, such as eczema. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
Mouse(665033) collagen, type VI, alpha 5
Rat(501047) collagen, type VI, alpha 5
domestic cat(101092138) collagen, type VI, alpha 5
cow(785805) collagen, type VI, alpha 5
Horse(100064173) collagen, type VI, alpha 5
dog(485659) collagen, type VI, alpha 5
domestic guinea pig(100717027) collagen, type VI, alpha 5
sheep(101118494) collagen, type VI, alpha 5
Domestic Rabbit(100340417) collagen, type VI, alpha 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153264 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153264 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153264 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU102781 MISSION® esiRNA esiRNA human AC128683.3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153264 Rosetta Predictions human pricing
NR_022012 Rosetta Predictions human pricing
XM_576462 Rosetta Predictions rat pricing
XR_001683 Rosetta Predictions mouse pricing
XR_035671 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153264 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367135 predicted 1620
2 SASI_Hs02_00367136 predicted 3764
3 SASI_Hs02_00367137 predicted 2877
4 SASI_Hs02_00367138 predicted 2359
5 SASI_Hs02_00367139 predicted 6338
6 SASI_Hs02_00367140 predicted 2786
7 SASI_Hs01_00090231 predicted 7914
8 SASI_Hs02_00367141 predicted 2859
9 SASI_Hs02_00367142 predicted 6382
10 SASI_Hs02_00367143 predicted 610
11 SASI_Hs01_00090227 predicted 1738
12 SASI_Hs01_00090228 predicted 522
13 SASI_Hs01_00090229 predicted 1343
14 SASI_Hs01_00090230 predicted 216
15 SASI_Hs01_00090232 predicted 487
16 SASI_Hs01_00090233 predicted 1392
17 SASI_Hs01_00090234 predicted 1945
18 SASI_Hs01_00090235 predicted 1068
19 SASI_Hs01_00090236 predicted 1382
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_022012 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00381572 predicted 1618
2 SASI_Hs02_00381573 predicted 8633
3 SASI_Hs02_00381574 predicted 2875
4 SASI_Hs02_00381575 predicted 2356
5 SASI_Hs02_00381576 predicted 6343
6 SASI_Hs02_00381577 predicted 2783
7 SASI_Hs02_00381578 predicted 7913
8 SASI_Hs02_00381579 predicted 2866
9 SASI_Hs02_00381580 predicted 8372
10 SASI_Hs02_00381581 predicted 3933
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576462 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00405403 predicted 1424
2 SASI_Rn02_00405404 predicted 1273
3 SASI_Rn02_00405405 predicted 1417
4 SASI_Rn02_00405406 predicted 1269
5 SASI_Rn02_00405407 predicted 1544
6 SASI_Rn02_00405408 predicted 1170
7 SASI_Rn02_00405409 predicted 1095
8 SASI_Rn02_00405410 predicted 1254
9 SASI_Rn02_00405411 predicted 1287
10 SASI_Rn02_00405412 predicted 1371
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_001683 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00267602 predicted 2023
2 SASI_Mm01_00267603 predicted 3767
3 SASI_Mm01_00267604 predicted 1533
4 SASI_Mm01_00267605 predicted 1223
5 SASI_Mm01_00267606 predicted 1242
6 SASI_Mm01_00267607 predicted 3987
7 SASI_Mm01_00267608 predicted 3330
8 SASI_Mm01_00267609 predicted 3254
9 SASI_Mm01_00267610 predicted 1297
10 SASI_Mm01_00267611 predicted 2074
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_035671 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00483884 predicted 2023
2 SASI_Mm02_00483885 predicted 3767
3 SASI_Mm02_00483886 predicted 1545
4 SASI_Mm02_00483887 predicted 1248
5 SASI_Mm02_00483888 predicted 3332
6 SASI_Mm02_00483889 predicted 8635
7 SASI_Mm02_00483890 predicted 5644
8 SASI_Mm02_00483891 predicted 5530
9 SASI_Mm02_00483892 predicted 817
10 SASI_Mm02_00483893 predicted 7351
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153264
COL6A5 MISSION shRNA Bacterial Glycerol Stock
collagen, type VI, alpha 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153264.2-1553s1c1
Sequence:CCGGCGAGACCAACTCTTTAGACAACTCGAGTTGTCTAAAGAGTTGGTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153264.2-1015s1c1
Sequence:CCGGGCCAAATGTTTGAGCCACAAACTCGAGTTTGTGGCTCAAACATTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153264.2-1727s1c1
Sequence:CCGGGCCAGATTGGAACTATATCATCTCGAGATGATATAGTTCCAATCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153264.2-628s1c1
Sequence:CCGGGCTACGTCATATTTGTGATTTCTCGAGAAATCACAAATATGACGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116417    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153264.2-2424s1c1
Sequence:CCGGCCATAGTTAATGCTTTCTCTTCTCGAGAAGAGAAAGCATTAACTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153264.5-3577s21c1
Sequence:CCGGTGTCAGACTTAATCGATAATTCTCGAGAATTATCGATTAAGTCTGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153264.5-5756s21c1
Sequence:CCGGATATCCAACAGAGCTAGTATTCTCGAGAATACTAGCTCTGTTGGATATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153264.5-2951s21c1
Sequence:CCGGGGATCATTCAGGTAGCATAAACTCGAGTTTATGCTACCTGAATGATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153264
COL6A5 MISSION shRNA shRNA Plasmid DNA
collagen, type VI, alpha 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153264.2-1553s1c1
Sequence:CCGGCGAGACCAACTCTTTAGACAACTCGAGTTGTCTAAAGAGTTGGTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153264.2-1015s1c1
Sequence:CCGGGCCAAATGTTTGAGCCACAAACTCGAGTTTGTGGCTCAAACATTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153264.2-1727s1c1
Sequence:CCGGGCCAGATTGGAACTATATCATCTCGAGATGATATAGTTCCAATCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153264.2-628s1c1
Sequence:CCGGGCTACGTCATATTTGTGATTTCTCGAGAAATCACAAATATGACGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116417    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153264.2-2424s1c1
Sequence:CCGGCCATAGTTAATGCTTTCTCTTCTCGAGAAGAGAAAGCATTAACTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153264.5-3577s21c1
Sequence:CCGGTGTCAGACTTAATCGATAATTCTCGAGAATTATCGATTAAGTCTGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153264.5-5756s21c1
Sequence:CCGGATATCCAACAGAGCTAGTATTCTCGAGAATACTAGCTCTGTTGGATATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153264.5-2951s21c1
Sequence:CCGGGGATCATTCAGGTAGCATAAACTCGAGTTTATGCTACCTGAATGATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153264
COL6A5 MISSION shRNA Lentiviral Transduction Particles
collagen, type VI, alpha 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153264.2-1553s1c1
Sequence:CCGGCGAGACCAACTCTTTAGACAACTCGAGTTGTCTAAAGAGTTGGTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153264.2-1015s1c1
Sequence:CCGGGCCAAATGTTTGAGCCACAAACTCGAGTTTGTGGCTCAAACATTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153264.2-1727s1c1
Sequence:CCGGGCCAGATTGGAACTATATCATCTCGAGATGATATAGTTCCAATCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153264.2-628s1c1
Sequence:CCGGGCTACGTCATATTTGTGATTTCTCGAGAAATCACAAATATGACGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116417    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153264.2-2424s1c1
Sequence:CCGGCCATAGTTAATGCTTTCTCTTCTCGAGAAGAGAAAGCATTAACTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153264.5-3577s21c1
Sequence:CCGGTGTCAGACTTAATCGATAATTCTCGAGAATTATCGATTAAGTCTGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153264.5-5756s21c1
Sequence:CCGGATATCCAACAGAGCTAGTATTCTCGAGAATACTAGCTCTGTTGGATATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153264.5-2951s21c1
Sequence:CCGGGGATCATTCAGGTAGCATAAACTCGAGTTTATGCTACCTGAATGATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)