EMAIL THIS PAGE TO A FRIEND

COL6A6

collagen, type VI, alpha 6

61 Gene Product Result for
UniProtKB ID: A6NMZ7, A7DZQ0, A7DZQ1, A7DZQ2, Q69YT0
Gene ID:
Mouse(245026) collagen, type VI, alpha 6
Rat(315979) collagen, type VI, alpha 6
sheep(101111424) collagen, type VI, alpha 6
Domestic Rabbit(100339915) collagen, type VI, alpha 6
domestic guinea pig(100717588) collagen, type VI, alpha 6
naked mole-rat(101715830) collagen, type VI, alpha 6
Zebrafish(564005) collagen, type VI, alpha 6
cow(530102) collagen, type VI, alpha 6
Horse(100064285) collagen, type VI, alpha 6
domestic cat(101095676) collagen, type VI, alpha 6
dog(610649) collagen, type VI, alpha 6
chicken(428448) collagen, type VI, alpha 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001102608 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001102608 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001102608 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172927 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172927 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172927 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU012631 MISSION® esiRNA esiRNA targeting mouse E330026B02Rik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001102608 Rosetta Predictions human pricing
XM_067585 Rosetta Predictions human pricing
XM_236593 Rosetta Predictions rat pricing
NM_001102607 Rosetta Predictions mouse pricing
NM_172927 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102608 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323389 predicted 3508
2 SASI_Hs02_00323390 predicted 6186
3 SASI_Hs02_00323391 predicted 2113
4 SASI_Hs02_00323392 predicted 2574
5 SASI_Hs02_00323393 predicted 1531
6 SASI_Hs02_00323394 predicted 1718
7 SASI_Hs02_00323395 predicted 700
8 SASI_Hs02_00323396 predicted 6107
9 SASI_Hs02_00323397 predicted 6838
10 SASI_Hs02_00323398 predicted 3039
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_067585 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00270638 predicted 3803
2 SASI_Hs01_00270639 predicted 2402
3 SASI_Hs01_00270640 predicted 1779
4 SASI_Hs01_00270641 predicted 2106
5 SASI_Hs01_00270642 predicted 1977
6 SASI_Hs01_00270643 predicted 1041
7 SASI_Hs01_00270644 predicted 953
8 SASI_Hs01_00270645 predicted 4393
9 SASI_Hs01_00270646 predicted 3325
10 SASI_Hs01_00270647 predicted 4279
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236593 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390169 predicted 1114
2 SASI_Rn02_00390170 predicted 1436
3 SASI_Rn02_00390171 predicted 5983
4 SASI_Rn02_00390172 predicted 3677
5 SASI_Rn02_00390173 predicted 6241
6 SASI_Rn02_00390174 predicted 1899
7 SASI_Rn02_00390175 predicted 3137
8 SASI_Rn02_00390176 predicted 1742
9 SASI_Rn02_00390177 predicted 4400
10 SASI_Rn02_00390178 predicted 927
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102607 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00302999 predicted 2285
2 SASI_Mm02_00303000 predicted 1520
3 SASI_Mm02_00303001 predicted 2304
4 SASI_Mm02_00303002 predicted 2062
5 SASI_Mm02_00303003 predicted 2333
6 SASI_Mm02_00303004 predicted 2822
7 SASI_Mm02_00303005 predicted 2751
8 SASI_Mm02_00303006 predicted 1109
9 SASI_Mm02_00303007 predicted 814
10 SASI_Mm02_00303008 predicted 1532
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172927 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114402 predicted 2318
2 SASI_Mm01_00114403 predicted 1546
3 SASI_Mm01_00114404 predicted 2336
4 SASI_Mm01_00114405 predicted 2096
5 SASI_Mm01_00114406 predicted 2374
6 SASI_Mm01_00114407 predicted 2857
7 SASI_Mm01_00114408 predicted 2788
8 SASI_Mm01_00114409 predicted 1146
9 SASI_Mm02_00344934 predicted 850
10 SASI_Mm02_00344935 predicted 1565
11 SASI_Mm01_00114401 predicted 2494
12 SASI_Mm01_00114410 predicted 3648
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001102608
COL6A6 MISSION shRNA Bacterial Glycerol Stock
collagen, type VI, alpha 6
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102608.1-2672s21c1
Sequence:CCGGGCCATGGGTGGCAGTACTTATCTCGAGATAAGTACTGCCACCCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102608.1-2264s21c1
Sequence:CCGGCTTCGGCAAGAAGGTGTAATCCTCGAGGATTACACCTTCTTGCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102608.1-3516s21c1
Sequence:CCGGATGAACTGAAGAAGGTCAATACTCGAGTATTGACCTTCTTCAGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102608.1-2227s21c1
Sequence:CCGGTGAAGCTCAGGACATAGTAAACTCGAGTTTACTATGTCCTGAGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001102608.1-6940s21c1
Sequence:CCGGCCCTGCATTCATTGGTATTAACTCGAGTTAATACCAATGAATGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001102608
COL6A6 MISSION shRNA shRNA Plasmid DNA
collagen, type VI, alpha 6
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102608.1-2672s21c1
Sequence:CCGGGCCATGGGTGGCAGTACTTATCTCGAGATAAGTACTGCCACCCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102608.1-2264s21c1
Sequence:CCGGCTTCGGCAAGAAGGTGTAATCCTCGAGGATTACACCTTCTTGCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102608.1-3516s21c1
Sequence:CCGGATGAACTGAAGAAGGTCAATACTCGAGTATTGACCTTCTTCAGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102608.1-2227s21c1
Sequence:CCGGTGAAGCTCAGGACATAGTAAACTCGAGTTTACTATGTCCTGAGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001102608.1-6940s21c1
Sequence:CCGGCCCTGCATTCATTGGTATTAACTCGAGTTAATACCAATGAATGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001102608
COL6A6 MISSION shRNA Lentiviral Transduction Particles
collagen, type VI, alpha 6
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102608.1-2672s21c1
Sequence:CCGGGCCATGGGTGGCAGTACTTATCTCGAGATAAGTACTGCCACCCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102608.1-2264s21c1
Sequence:CCGGCTTCGGCAAGAAGGTGTAATCCTCGAGGATTACACCTTCTTGCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102608.1-3516s21c1
Sequence:CCGGATGAACTGAAGAAGGTCAATACTCGAGTATTGACCTTCTTCAGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102608.1-2227s21c1
Sequence:CCGGTGAAGCTCAGGACATAGTAAACTCGAGTTTACTATGTCCTGAGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001102608.1-6940s21c1
Sequence:CCGGCCCTGCATTCATTGGTATTAACTCGAGTTAATACCAATGAATGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172927
COL6A6 MISSION shRNA Bacterial Glycerol Stock
collagen, type VI, alpha 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172927.1-980s1c1
Sequence:CCGGGAGGACCTAGATCATCTTAAACTCGAGTTTAAGATGATCTAGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172927.1-3727s1c1
Sequence:CCGGGCATAACTTCGACGAGCTAAACTCGAGTTTAGCTCGTCGAAGTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172927.1-2328s1c1
Sequence:CCGGTGACTCACATTGGAGAAACAACTCGAGTTGTTTCTCCAATGTGAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172927.1-985s1c1
Sequence:CCGGCCTAGATCATCTTAAAGCATTCTCGAGAATGCTTTAAGATGATCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172927.1-1597s1c1
Sequence:CCGGGCCCACAGACTTCCATGAAATCTCGAGATTTCATGGAAGTCTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172927
COL6A6 MISSION shRNA shRNA Plasmid DNA
collagen, type VI, alpha 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172927.1-980s1c1
Sequence:CCGGGAGGACCTAGATCATCTTAAACTCGAGTTTAAGATGATCTAGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172927.1-3727s1c1
Sequence:CCGGGCATAACTTCGACGAGCTAAACTCGAGTTTAGCTCGTCGAAGTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172927.1-2328s1c1
Sequence:CCGGTGACTCACATTGGAGAAACAACTCGAGTTGTTTCTCCAATGTGAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172927.1-985s1c1
Sequence:CCGGCCTAGATCATCTTAAAGCATTCTCGAGAATGCTTTAAGATGATCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172927.1-1597s1c1
Sequence:CCGGGCCCACAGACTTCCATGAAATCTCGAGATTTCATGGAAGTCTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172927
COL6A6 MISSION shRNA Lentiviral Transduction Particles
collagen, type VI, alpha 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172927.1-980s1c1
Sequence:CCGGGAGGACCTAGATCATCTTAAACTCGAGTTTAAGATGATCTAGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172927.1-3727s1c1
Sequence:CCGGGCATAACTTCGACGAGCTAAACTCGAGTTTAGCTCGTCGAAGTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172927.1-2328s1c1
Sequence:CCGGTGACTCACATTGGAGAAACAACTCGAGTTGTTTCTCCAATGTGAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172927.1-985s1c1
Sequence:CCGGCCTAGATCATCTTAAAGCATTCTCGAGAATGCTTTAAGATGATCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172927.1-1597s1c1
Sequence:CCGGGCCCACAGACTTCCATGAAATCTCGAGATTTCATGGAAGTCTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks