EMAIL THIS PAGE TO A FRIEND

COL7A1

collagen, type VII, alpha 1

Synonyms: EBD1 EBDCT EBR1
UniProtKB ID: Q02388, Q14054, Q16507
Gene ID:
Human(1294) Summary: This gene encodes the alpha chain of type VII collagen. The type VII collagen fibril, composed of three identical alpha collagen chains, is restricted to the basement zone beneath stratified squamous epithelia. It functions as an anchoring fibril between the external epithelia and the underlying stroma. Mutations in this gene are associated with all forms of dystrophic epidermolysis bullosa. In the absence of mutations, however, an acquired form of this disease can result from an autoimmune response made to type VII collagen. [provided by RefSeq, Jul 2008]
Mouse(12836) collagen, type VII, alpha 1
Rat(301012) collagen, type VII, alpha 1
Zebrafish(557081) collagen, type VII, alpha 1
Zebrafish(100332562) collagen, type VII, alpha 1
domestic cat(101089247) collagen, type VII, alpha 1
cow(507133) collagen, type VII, alpha 1
Horse(100063696) collagen, type VII, alpha 1
dog(403467) collagen, type VII, alpha 1
chicken(427584) collagen, type VII, alpha 1
naked mole-rat(101718816) collagen, type VII, alpha 1
domestic guinea pig(100726045) collagen, type VII, alpha 1
sheep(101119261) collagen, type VII, alpha 1
Domestic Rabbit(100356561) collagen, type VII, alpha 1
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA042420 Anti-COL7A1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4500390 Anti-Collagen VII α1 antibody produced in rabbit affinity isolated antibody human, mouse
immunofluorescence, immunohistochemistry pricing
SAB2500259 Anti-Collagen, Type VII antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, mouse, canine, human
ELISA, western blot pricing
C6805 Monoclonal Anti-Collagen, Type VII antibody produced in mouse clone LH7.2, ascites fluid pig, goat, monkey, marmoset, bovine, guinea pig, sheep, human
dot blot, ELISA, immunocytochemistry, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007738 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007738 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007738 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000094 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000094 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000094 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU121511 MISSION® esiRNA esiRNA human COL7A1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000094 Rosetta Predictions human pricing
NM_001106858 Rosetta Predictions rat pricing
NM_007738 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000094 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155170 predicted 1427
2 SASI_Hs01_00155171 predicted 2171
3 SASI_Hs01_00155173 predicted 2452
4 SASI_Hs01_00155174 predicted 2230
5 SASI_Hs02_00301857 predicted 8539
6 SASI_Hs02_00301858 predicted 2235
7 SASI_Hs01_00155175 predicted 3428
8 SASI_Hs01_00155176 predicted 1927
9 SASI_Hs02_00301859 predicted 2455
10 SASI_Hs01_00155177 predicted 5378
11 SASI_Hs01_00155169 predicted 3416
12 SASI_Hs01_00155172 predicted 205
13 SASI_Hs01_00155178 predicted 1235
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106858 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223096 predicted 2178
2 SASI_Rn02_00223097 predicted 1048
3 SASI_Rn02_00223098 predicted 1673
4 SASI_Rn02_00223099 predicted 3676
5 SASI_Rn02_00223100 predicted 2235
6 SASI_Rn02_00223101 predicted 3488
7 SASI_Rn02_00223102 predicted 4051
8 SASI_Rn02_00223103 predicted 2901
9 SASI_Rn02_00223104 predicted 331
10 SASI_Rn02_00223105 predicted 3195
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007738 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046487 predicted 1670
2 SASI_Mm01_00046488 predicted 8666
3 SASI_Mm02_00312335 predicted 501
4 SASI_Mm01_00046489 predicted 8520
5 SASI_Mm01_00046490 predicted 1679
6 SASI_Mm01_00046491 predicted 2752
7 SASI_Mm01_00046492 predicted 1433
8 SASI_Mm01_00046493 predicted 2331
9 SASI_Mm01_00046494 predicted 330
10 SASI_Mm01_00046495 predicted 2346
11 SASI_Mm01_00046496 predicted 2246
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007738
COL7A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type VII, alpha 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007738.1-330s1c1
Sequence:CCGGGCTCAGCTATAAAGGTGGTAACTCGAGTTACCACCTTTATAGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007738.1-3322s1c1
Sequence:CCGGCCACTGAATAGTTCCCATGATCTCGAGATCATGGGAACTATTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080133    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007738.1-8962s1c1
Sequence:CCGGGCACATGAGCATGTCCACTATCTCGAGATAGTGGACATGCTCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007738.1-1241s1c1
Sequence:CCGGCCGCATCTTCTGTTGAGCAAACTCGAGTTTGCTCAACAGAAGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007738.1-8390s1c1
Sequence:CCGGGCCAGTTTATTGCGTCTGGATCTCGAGATCCAGACGCAATAAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007738
COL7A1 MISSION shRNA shRNA Plasmid DNA
collagen, type VII, alpha 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007738.1-330s1c1
Sequence:CCGGGCTCAGCTATAAAGGTGGTAACTCGAGTTACCACCTTTATAGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007738.1-3322s1c1
Sequence:CCGGCCACTGAATAGTTCCCATGATCTCGAGATCATGGGAACTATTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080133    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007738.1-8962s1c1
Sequence:CCGGGCACATGAGCATGTCCACTATCTCGAGATAGTGGACATGCTCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007738.1-1241s1c1
Sequence:CCGGCCGCATCTTCTGTTGAGCAAACTCGAGTTTGCTCAACAGAAGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007738.1-8390s1c1
Sequence:CCGGGCCAGTTTATTGCGTCTGGATCTCGAGATCCAGACGCAATAAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007738
COL7A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type VII, alpha 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007738.1-330s1c1
Sequence:CCGGGCTCAGCTATAAAGGTGGTAACTCGAGTTACCACCTTTATAGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007738.1-3322s1c1
Sequence:CCGGCCACTGAATAGTTCCCATGATCTCGAGATCATGGGAACTATTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080133    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007738.1-8962s1c1
Sequence:CCGGGCACATGAGCATGTCCACTATCTCGAGATAGTGGACATGCTCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007738.1-1241s1c1
Sequence:CCGGCCGCATCTTCTGTTGAGCAAACTCGAGTTTGCTCAACAGAAGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007738.1-8390s1c1
Sequence:CCGGGCCAGTTTATTGCGTCTGGATCTCGAGATCCAGACGCAATAAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000094
VALIDATED
COL7A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type VII, alpha 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000094.x-2552s1c1
Sequence:CCGGGCACCAGATACTCCCAGGAAACTCGAGTTTCCTGGGAGTATCTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_000094.x-1767s1c1
Sequence:CCGGCAGACAGCATTCGACTTGGATCTCGAGATCCAAGTCGAATGCTGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000094.x-3576s1c1
Sequence:CCGGGTGATGGTTCTGCTAGTGGATCTCGAGATCCACTAGCAGAACCATCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000094.x-9202s1c1
Sequence:CCGGTGACCCAAGCCTGTGATGACACTCGAGTGTCATCACAGGCTTGGGTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_000094.x-1329s1c1
Sequence:CCGGGCTCGCACTGACGCTTCTGTTCTCGAGAACAGAAGCGTCAGTGCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_000094.3-1869s21c1
Sequence:CCGGGAGCCAGTGGATTTCGGATTACTCGAGTAATCCGAAATCCACTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_000094.3-3503s21c1
Sequence:CCGGCCCTTGAGAGGTGACATATTCCTCGAGGAATATGTCACCTCTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000094.3-1178s21c1
Sequence:CCGGGTGACCGTGAGCACCCTATTTCTCGAGAAATAGGGTGCTCACGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_000094.3-1232s21c1
Sequence:CCGGGCTCGCACTGACGCTTCTGTTCTCGAGAACAGAAGCGTCAGTGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000094.3-8943s21c1
Sequence:CCGGTGCGTGTGCACGTCCGTTATTCTCGAGAATAACGGACGTGCACACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000094
VALIDATED
COL7A1 MISSION shRNA shRNA Plasmid DNA
collagen, type VII, alpha 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000094.x-2552s1c1
Sequence:CCGGGCACCAGATACTCCCAGGAAACTCGAGTTTCCTGGGAGTATCTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_000094.x-1767s1c1
Sequence:CCGGCAGACAGCATTCGACTTGGATCTCGAGATCCAAGTCGAATGCTGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000094.x-3576s1c1
Sequence:CCGGGTGATGGTTCTGCTAGTGGATCTCGAGATCCACTAGCAGAACCATCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000094.x-9202s1c1
Sequence:CCGGTGACCCAAGCCTGTGATGACACTCGAGTGTCATCACAGGCTTGGGTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_000094.x-1329s1c1
Sequence:CCGGGCTCGCACTGACGCTTCTGTTCTCGAGAACAGAAGCGTCAGTGCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_000094.3-1869s21c1
Sequence:CCGGGAGCCAGTGGATTTCGGATTACTCGAGTAATCCGAAATCCACTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_000094.3-3503s21c1
Sequence:CCGGCCCTTGAGAGGTGACATATTCCTCGAGGAATATGTCACCTCTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000094.3-1178s21c1
Sequence:CCGGGTGACCGTGAGCACCCTATTTCTCGAGAAATAGGGTGCTCACGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_000094.3-1232s21c1
Sequence:CCGGGCTCGCACTGACGCTTCTGTTCTCGAGAACAGAAGCGTCAGTGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000094.3-8943s21c1
Sequence:CCGGTGCGTGTGCACGTCCGTTATTCTCGAGAATAACGGACGTGCACACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000094
VALIDATED
COL7A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type VII, alpha 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000094.x-2552s1c1
Sequence:CCGGGCACCAGATACTCCCAGGAAACTCGAGTTTCCTGGGAGTATCTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_000094.x-1767s1c1
Sequence:CCGGCAGACAGCATTCGACTTGGATCTCGAGATCCAAGTCGAATGCTGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000094.x-3576s1c1
Sequence:CCGGGTGATGGTTCTGCTAGTGGATCTCGAGATCCACTAGCAGAACCATCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000094.x-9202s1c1
Sequence:CCGGTGACCCAAGCCTGTGATGACACTCGAGTGTCATCACAGGCTTGGGTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_000094.x-1329s1c1
Sequence:CCGGGCTCGCACTGACGCTTCTGTTCTCGAGAACAGAAGCGTCAGTGCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_000094.3-1869s21c1
Sequence:CCGGGAGCCAGTGGATTTCGGATTACTCGAGTAATCCGAAATCCACTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_000094.3-3503s21c1
Sequence:CCGGCCCTTGAGAGGTGACATATTCCTCGAGGAATATGTCACCTCTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000094.3-1178s21c1
Sequence:CCGGGTGACCGTGAGCACCCTATTTCTCGAGAAATAGGGTGCTCACGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_000094.3-1232s21c1
Sequence:CCGGGCTCGCACTGACGCTTCTGTTCTCGAGAACAGAAGCGTCAGTGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000094.3-8943s21c1
Sequence:CCGGTGCGTGTGCACGTCCGTTATTCTCGAGAATAACGGACGTGCACACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks