EMAIL THIS PAGE TO A FRIEND

COL8A1

collagen, type VIII, alpha 1

66 Gene Product Result for
Synonyms: C3orf7
UniProtKB ID: P27658, D3DN42, Q53XI6, Q96D07
Gene ID:
Human(1295) Summary: This gene encodes one of the two alpha chains of type VIII collagen. The gene product is a short chain collagen and a major component of the basement membrane of the corneal endothelium. The type VIII collagen fibril can be either a homo- or a heterotrimer. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Dec 2011]
Mouse(12837) collagen, type VIII, alpha 1
Rat(304021) collagen, type VIII, alpha 1
chicken(418378) collagen, type VIII, alpha 1
domestic cat(101098078) collagen, type VIII, alpha 1
dog(487950) collagen, type VIII, alpha 1
cow(538564) collagen, type VIII, alpha 1
Domestic Rabbit(100009383) collagen, type VIII, alpha 1
domestic guinea pig(100717829) collagen, type VIII, alpha 1
naked mole-rat(101711094) collagen, type VIII, alpha 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001850 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001850 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001850 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007739 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007739 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007739 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001850 Rosetta Predictions human pricing
NM_020351 Rosetta Predictions human pricing
NM_001107100 Rosetta Predictions rat pricing
NM_007739 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001850 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332668 predicted 2152
2 SASI_Hs01_00059736 predicted 2088
3 SASI_Hs01_00059737 predicted 2211
4 SASI_Hs01_00059738 predicted 2073
5 SASI_Hs01_00059739 predicted 567
6 SASI_Hs01_00059741 predicted 1986
7 SASI_Hs01_00059742 predicted 2078
8 SASI_Hs02_00332669 predicted 517
9 SASI_Hs01_00059743 predicted 2009
10 SASI_Hs01_00059744 predicted 963
11 SASI_Hs01_00059740 predicted 2145
12 SASI_Hs01_00059745 predicted 480
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020351 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00353288 predicted 2096
2 SASI_Hs01_00048170 predicted 2027
3 SASI_Hs01_00048171 predicted 2155
4 SASI_Hs01_00048172 predicted 2012
5 SASI_Hs01_00048173 predicted 507
6 SASI_Hs01_00048175 predicted 1927
7 SASI_Hs01_00048176 predicted 2010
8 SASI_Hs02_00353289 predicted 449
9 SASI_Hs01_00048177 predicted 1948
10 SASI_Hs01_00048178 predicted 897
11 SASI_Hs01_00048174 predicted 2077
12 SASI_Hs01_00048179 predicted 421
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107100 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225496 predicted 226
2 SASI_Rn02_00225497 predicted 987
3 SASI_Rn02_00225498 predicted 374
4 SASI_Rn02_00225499 predicted 210
5 SASI_Rn02_00225500 predicted 373
6 SASI_Rn02_00225501 predicted 214
7 SASI_Rn02_00225502 predicted 322
8 SASI_Rn02_00225503 predicted 2174
9 SASI_Rn02_00225504 predicted 307
10 SASI_Rn02_00225505 predicted 1434
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007739 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00177062 predicted 2197
2 SASI_Mm01_00177061 predicted 2059
3 SASI_Mm02_00312336 predicted 388
4 SASI_Mm01_00177063 predicted 2046
5 SASI_Mm02_00312337 predicted 244
6 SASI_Mm02_00312338 predicted 230
7 SASI_Mm01_00177065 predicted 1965
8 SASI_Mm01_00177067 predicted 1971
9 SASI_Mm01_00177068 predicted 669
10 SASI_Mm01_00177069 predicted 437
11 SASI_Mm01_00177064 predicted 415
12 SASI_Mm01_00177066 predicted 403
13 SASI_Mm01_00177070 predicted 323
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001850
VALIDATED
COL8A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type VIII, alpha 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001850.3-278s21c1
Sequence:CCGGGGGAGTGCTGCTTACCATTTCCTCGAGGAAATGGTAAGCAGCACTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001850.3-573s21c1
Sequence:CCGGGAAATACCATTAGCCAGTTTACTCGAGTAAACTGGCTAATGGTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001850.3-2304s21c1
Sequence:CCGGTACACGTACGACGAGTACAAACTCGAGTTTGTACTCGTCGTACGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001850.3-377s1c1
Sequence:CCGGGCCACCACAAATTCCACAATACTCGAGTATTGTGGAATTTGTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001850.3-2159s1c1
Sequence:CCGGGCTGTATAACGGCAGACAGAACTCGAGTTCTGTCTGCCGTTATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001850.3-661s1c1
Sequence:CCGGGTCATGGGATACCTGGAATTACTCGAGTAATTCCAGGTATCCCATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001850.3-2078s1c1
Sequence:CCGGAGCCTATGAGATGCCTGCATTCTCGAGAATGCAGGCATCTCATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001850.3-2079s1c1
Sequence:CCGGGCCTATGAGATGCCTGCATTTCTCGAGAAATGCAGGCATCTCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001850
VALIDATED
COL8A1 MISSION shRNA shRNA Plasmid DNA
collagen, type VIII, alpha 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001850.3-278s21c1
Sequence:CCGGGGGAGTGCTGCTTACCATTTCCTCGAGGAAATGGTAAGCAGCACTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001850.3-573s21c1
Sequence:CCGGGAAATACCATTAGCCAGTTTACTCGAGTAAACTGGCTAATGGTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001850.3-2304s21c1
Sequence:CCGGTACACGTACGACGAGTACAAACTCGAGTTTGTACTCGTCGTACGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001850.3-377s1c1
Sequence:CCGGGCCACCACAAATTCCACAATACTCGAGTATTGTGGAATTTGTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001850.3-2159s1c1
Sequence:CCGGGCTGTATAACGGCAGACAGAACTCGAGTTCTGTCTGCCGTTATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001850.3-661s1c1
Sequence:CCGGGTCATGGGATACCTGGAATTACTCGAGTAATTCCAGGTATCCCATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001850.3-2078s1c1
Sequence:CCGGAGCCTATGAGATGCCTGCATTCTCGAGAATGCAGGCATCTCATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001850.3-2079s1c1
Sequence:CCGGGCCTATGAGATGCCTGCATTTCTCGAGAAATGCAGGCATCTCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001850
VALIDATED
COL8A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type VIII, alpha 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001850.3-278s21c1
Sequence:CCGGGGGAGTGCTGCTTACCATTTCCTCGAGGAAATGGTAAGCAGCACTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001850.3-573s21c1
Sequence:CCGGGAAATACCATTAGCCAGTTTACTCGAGTAAACTGGCTAATGGTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001850.3-2304s21c1
Sequence:CCGGTACACGTACGACGAGTACAAACTCGAGTTTGTACTCGTCGTACGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001850.3-377s1c1
Sequence:CCGGGCCACCACAAATTCCACAATACTCGAGTATTGTGGAATTTGTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001850.3-2159s1c1
Sequence:CCGGGCTGTATAACGGCAGACAGAACTCGAGTTCTGTCTGCCGTTATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001850.3-661s1c1
Sequence:CCGGGTCATGGGATACCTGGAATTACTCGAGTAATTCCAGGTATCCCATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001850.3-2078s1c1
Sequence:CCGGAGCCTATGAGATGCCTGCATTCTCGAGAATGCAGGCATCTCATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001850.3-2079s1c1
Sequence:CCGGGCCTATGAGATGCCTGCATTTCTCGAGAAATGCAGGCATCTCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007739
VALIDATED
COL8A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type VIII, alpha 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000288329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007739.2-1975s21c1
Sequence:CCGGGCCAGATATGGGACTAGGAATCTCGAGATTCCTAGTCCCATATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007739.2-301s21c1
Sequence:CCGGCGGTGCCTACTATGGAATCAACTCGAGTTGATTCCATAGTAGGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007739.2-250s21c1
Sequence:CCGGGCTGGGAATACTGTTCATCATCTCGAGATGATGAACAGTATTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007739.2-443s21c1
Sequence:CCGGCCTCACATGCAGTATGGCAAACTCGAGTTTGCCATACTGCATGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007739.2-2705s21c1
Sequence:CCGGATTAGCTGTTCCATGTTATATCTCGAGATATAACATGGAACAGCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007739.1-81s1c1
Sequence:CCGGCGGTGCCTACTATGGAATCAACTCGAGTTGATTCCATAGTAGGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007739.1-30s1c1
Sequence:CCGGGCTGGGAATACTGTTCATCATCTCGAGATGATGAACAGTATTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007739.1-1752s1c1
Sequence:CCGGGCCAGATATGGGACTAGGAATCTCGAGATTCCTAGTCCCATATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007739.1-223s1c1
Sequence:CCGGCCTCACATGCAGTATGGCAAACTCGAGTTTGCCATACTGCATGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007739.1-1831s1c1
Sequence:CCGGGCCTATGAGATGCCTGCGTTTCTCGAGAAACGCAGGCATCTCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007739
VALIDATED
COL8A1 MISSION shRNA shRNA Plasmid DNA
collagen, type VIII, alpha 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000288329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007739.2-1975s21c1
Sequence:CCGGGCCAGATATGGGACTAGGAATCTCGAGATTCCTAGTCCCATATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007739.2-301s21c1
Sequence:CCGGCGGTGCCTACTATGGAATCAACTCGAGTTGATTCCATAGTAGGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007739.2-250s21c1
Sequence:CCGGGCTGGGAATACTGTTCATCATCTCGAGATGATGAACAGTATTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007739.2-443s21c1
Sequence:CCGGCCTCACATGCAGTATGGCAAACTCGAGTTTGCCATACTGCATGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007739.2-2705s21c1
Sequence:CCGGATTAGCTGTTCCATGTTATATCTCGAGATATAACATGGAACAGCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007739.1-81s1c1
Sequence:CCGGCGGTGCCTACTATGGAATCAACTCGAGTTGATTCCATAGTAGGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007739.1-30s1c1
Sequence:CCGGGCTGGGAATACTGTTCATCATCTCGAGATGATGAACAGTATTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007739.1-1752s1c1
Sequence:CCGGGCCAGATATGGGACTAGGAATCTCGAGATTCCTAGTCCCATATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007739.1-223s1c1
Sequence:CCGGCCTCACATGCAGTATGGCAAACTCGAGTTTGCCATACTGCATGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007739.1-1831s1c1
Sequence:CCGGGCCTATGAGATGCCTGCGTTTCTCGAGAAACGCAGGCATCTCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007739
VALIDATED
COL8A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type VIII, alpha 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000288329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007739.2-1975s21c1
Sequence:CCGGGCCAGATATGGGACTAGGAATCTCGAGATTCCTAGTCCCATATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007739.2-301s21c1
Sequence:CCGGCGGTGCCTACTATGGAATCAACTCGAGTTGATTCCATAGTAGGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007739.2-250s21c1
Sequence:CCGGGCTGGGAATACTGTTCATCATCTCGAGATGATGAACAGTATTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007739.2-443s21c1
Sequence:CCGGCCTCACATGCAGTATGGCAAACTCGAGTTTGCCATACTGCATGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007739.2-2705s21c1
Sequence:CCGGATTAGCTGTTCCATGTTATATCTCGAGATATAACATGGAACAGCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007739.1-81s1c1
Sequence:CCGGCGGTGCCTACTATGGAATCAACTCGAGTTGATTCCATAGTAGGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007739.1-30s1c1
Sequence:CCGGGCTGGGAATACTGTTCATCATCTCGAGATGATGAACAGTATTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007739.1-1752s1c1
Sequence:CCGGGCCAGATATGGGACTAGGAATCTCGAGATTCCTAGTCCCATATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007739.1-223s1c1
Sequence:CCGGCCTCACATGCAGTATGGCAAACTCGAGTTTGCCATACTGCATGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007739.1-1831s1c1
Sequence:CCGGGCCTATGAGATGCCTGCGTTTCTCGAGAAACGCAGGCATCTCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks