EMAIL THIS PAGE TO A FRIEND

COL8A2

collagen, type VIII, alpha 2

92 Gene Product Result for
Synonyms: FECD FECD1 PPCD PPCD2
UniProtKB ID: P25067, Q5JV31, Q8TEJ5
Gene ID:
Human(1296) Summary: This gene encodes the alpha 2 chain of type VIII collagen. The protein is a major component of the basement membrane of the corneal endothelium and forms homo- or heterotrimers with alpha 1 (VIII) type collagens. Defects in this gene are associated with Fuchs endothelial corneal dystrophy and posterior polymorphous corneal dystrophy type 2. [provided by RefSeq, Dec 2009]
Mouse(329941) collagen, type VIII, alpha 2
Rat(313592) collagen, type VIII, alpha 2
Zebrafish(794479) collagen, type VIII, alpha 2
cow(539415) collagen, type VIII, alpha 2
domestic cat(101087762) collagen, type VIII, alpha 2
chicken(428221) collagen, type VIII, alpha 2
naked mole-rat(101718336) collagen, type VIII, alpha 2
domestic guinea pig(100719425) collagen, type VIII, alpha 2
sheep(101117040) collagen, type VIII, alpha 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199473 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199473 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199473 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005202 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005202 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005202 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU155251 MISSION® esiRNA esiRNA human COL8A2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005202 Rosetta Predictions human pricing
XM_001057987 Rosetta Predictions rat pricing
XM_233542 Rosetta Predictions rat pricing
NM_199473 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005202 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076862 predicted 1940
2 SASI_Hs01_00076863 predicted 1777
3 SASI_Hs01_00076864 predicted 1871
4 SASI_Hs01_00076865 predicted 2048
5 SASI_Hs01_00076866 predicted 1857
6 SASI_Hs01_00076867 predicted 1196
7 SASI_Hs01_00076868 predicted 1935
8 SASI_Hs01_00076869 predicted 2269
9 SASI_Hs01_00076870 predicted 2071
10 SASI_Hs01_00076871 predicted 186
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057987 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00288180 predicted 1912
2 SASI_Rn02_00288181 predicted 2022
3 SASI_Rn02_00288182 predicted 1763
4 SASI_Rn02_00288183 predicted 1672
5 SASI_Rn02_00288184 predicted 1176
6 SASI_Rn02_00288185 predicted 1594
7 SASI_Rn02_00288186 predicted 1849
8 SASI_Rn02_00288187 predicted 1754
9 SASI_Rn02_00288188 predicted 1876
10 SASI_Rn02_00288189 predicted 1790
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233542 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387854 predicted 1919
2 SASI_Rn02_00387855 predicted 2028
3 SASI_Rn02_00387856 predicted 2033
4 SASI_Rn02_00387857 predicted 1910
5 SASI_Rn02_00387858 predicted 481
6 SASI_Rn02_00387859 predicted 1175
7 SASI_Rn02_00387860 predicted 2025
8 SASI_Rn02_00387861 predicted 352
9 SASI_Rn02_00387862 predicted 1918
10 SASI_Rn02_00387863 predicted 1125
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199473 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034825 predicted 2439
2 SASI_Mm01_00034826 predicted 1110
3 SASI_Mm01_00034827 predicted 2222
4 SASI_Mm01_00034828 predicted 1962
5 SASI_Mm01_00034829 predicted 1903
6 SASI_Mm01_00034830 predicted 1865
7 SASI_Mm01_00034831 predicted 2229
8 SASI_Mm01_00034832 predicted 2048
9 SASI_Mm01_00034833 predicted 2269
10 SASI_Mm01_00034834 predicted 2034
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199473
COL8A2 MISSION shRNA Bacterial Glycerol Stock
collagen, type VIII, alpha 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091603    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199473.1-3983s1c1
Sequence:CCGGGCCTTTAGAGAAGGATTCTAACTCGAGTTAGAATCCTTCTCTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199473.1-687s1c1
Sequence:CCGGCAGGTATTACTGTCCCTGGAACTCGAGTTCCAGGGACAGTAATACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199473.1-1516s1c1
Sequence:CCGGCCTAGGACAGAAAGGTGACTTCTCGAGAAGTCACCTTTCTGTCCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199473.1-1364s1c1
Sequence:CCGGCGAGGAGACCAAGGGCCTAATCTCGAGATTAGGCCCTTGGTCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199473.1-2251s1c1
Sequence:CCGGCGAGTACATCCATTCGTCCTTCTCGAGAAGGACGAATGGATGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199473
COL8A2 MISSION shRNA shRNA Plasmid DNA
collagen, type VIII, alpha 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091603    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199473.1-3983s1c1
Sequence:CCGGGCCTTTAGAGAAGGATTCTAACTCGAGTTAGAATCCTTCTCTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199473.1-687s1c1
Sequence:CCGGCAGGTATTACTGTCCCTGGAACTCGAGTTCCAGGGACAGTAATACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199473.1-1516s1c1
Sequence:CCGGCCTAGGACAGAAAGGTGACTTCTCGAGAAGTCACCTTTCTGTCCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199473.1-1364s1c1
Sequence:CCGGCGAGGAGACCAAGGGCCTAATCTCGAGATTAGGCCCTTGGTCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199473.1-2251s1c1
Sequence:CCGGCGAGTACATCCATTCGTCCTTCTCGAGAAGGACGAATGGATGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199473
COL8A2 MISSION shRNA Lentiviral Transduction Particles
collagen, type VIII, alpha 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091603    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199473.1-3983s1c1
Sequence:CCGGGCCTTTAGAGAAGGATTCTAACTCGAGTTAGAATCCTTCTCTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199473.1-687s1c1
Sequence:CCGGCAGGTATTACTGTCCCTGGAACTCGAGTTCCAGGGACAGTAATACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199473.1-1516s1c1
Sequence:CCGGCCTAGGACAGAAAGGTGACTTCTCGAGAAGTCACCTTTCTGTCCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199473.1-1364s1c1
Sequence:CCGGCGAGGAGACCAAGGGCCTAATCTCGAGATTAGGCCCTTGGTCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199473.1-2251s1c1
Sequence:CCGGCGAGTACATCCATTCGTCCTTCTCGAGAAGGACGAATGGATGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005202
VALIDATED
COL8A2 MISSION shRNA Bacterial Glycerol Stock
collagen, type VIII, alpha 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005202.1-1934s1c1
Sequence:CCGGCCGGCCACCTATACCTACGATCTCGAGATCGTAGGTATAGGTGGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005202.1-1939s1c1
Sequence:CCGGCACCTATACCTACGATGAGTACTCGAGTACTCATCGTAGGTATAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005202.1-508s1c1
Sequence:CCGGAGGCATTACTATCCCTGGAAACTCGAGTTTCCAGGGATAGTAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005202.1-191s1c1
Sequence:CCGGCAGTACCTGGAAATGCCTCTACTCGAGTAGAGGCATTTCCAGGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083088    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005202.1-3721s1c1
Sequence:CCGGGCCCACAACTTCTCCAAACAACTCGAGTTGTTTGGAGAAGTTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371878    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005202.1-2237s21c1
Sequence:CCGGTTGGCCCGAGGAGACTAACTTCTCGAGAAGTTAGTCTCCTCGGGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371820    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005202.1-2270s21c1
Sequence:CCGGCATGCAGGCTGAGATTGTTTCCTCGAGGAAACAATCTCAGCCTGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005202.1-1769s21c1
Sequence:CCGGTCGGGCATGCCCGTGAAATTTCTCGAGAAATTTCACGGGCATGCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005202
VALIDATED
COL8A2 MISSION shRNA shRNA Plasmid DNA
collagen, type VIII, alpha 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005202.1-1934s1c1
Sequence:CCGGCCGGCCACCTATACCTACGATCTCGAGATCGTAGGTATAGGTGGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005202.1-1939s1c1
Sequence:CCGGCACCTATACCTACGATGAGTACTCGAGTACTCATCGTAGGTATAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005202.1-508s1c1
Sequence:CCGGAGGCATTACTATCCCTGGAAACTCGAGTTTCCAGGGATAGTAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005202.1-191s1c1
Sequence:CCGGCAGTACCTGGAAATGCCTCTACTCGAGTAGAGGCATTTCCAGGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083088    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005202.1-3721s1c1
Sequence:CCGGGCCCACAACTTCTCCAAACAACTCGAGTTGTTTGGAGAAGTTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371878    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005202.1-2237s21c1
Sequence:CCGGTTGGCCCGAGGAGACTAACTTCTCGAGAAGTTAGTCTCCTCGGGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371820    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005202.1-2270s21c1
Sequence:CCGGCATGCAGGCTGAGATTGTTTCCTCGAGGAAACAATCTCAGCCTGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005202.1-1769s21c1
Sequence:CCGGTCGGGCATGCCCGTGAAATTTCTCGAGAAATTTCACGGGCATGCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005202
VALIDATED
COL8A2 MISSION shRNA Lentiviral Transduction Particles
collagen, type VIII, alpha 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005202.1-1934s1c1
Sequence:CCGGCCGGCCACCTATACCTACGATCTCGAGATCGTAGGTATAGGTGGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005202.1-1939s1c1
Sequence:CCGGCACCTATACCTACGATGAGTACTCGAGTACTCATCGTAGGTATAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005202.1-508s1c1
Sequence:CCGGAGGCATTACTATCCCTGGAAACTCGAGTTTCCAGGGATAGTAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005202.1-191s1c1
Sequence:CCGGCAGTACCTGGAAATGCCTCTACTCGAGTAGAGGCATTTCCAGGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083088    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005202.1-3721s1c1
Sequence:CCGGGCCCACAACTTCTCCAAACAACTCGAGTTGTTTGGAGAAGTTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371878    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005202.1-2237s21c1
Sequence:CCGGTTGGCCCGAGGAGACTAACTTCTCGAGAAGTTAGTCTCCTCGGGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371820    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005202.1-2270s21c1
Sequence:CCGGCATGCAGGCTGAGATTGTTTCCTCGAGGAAACAATCTCAGCCTGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005202.1-1769s21c1
Sequence:CCGGTCGGGCATGCCCGTGAAATTTCTCGAGAAATTTCACGGGCATGCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks