EMAIL THIS PAGE TO A FRIEND

COL9A1

collagen, type IX, alpha 1

76 Gene Product Result for
Synonyms: DJ149L1.1.2 EDM6 MED STL4
Gene ID:
Human(1297) Summary: This gene encodes one of the three alpha chains of type IX collagen, which is a minor (5-20%) collagen component of hyaline cartilage. Type IX collagen is usually found in tissues containing type II collagen, a fibrillar collagen. Studies in knockout mice have shown that synthesis of the alpha 1 chain is essential for assembly of type IX collagen molecules, a heterotrimeric molecule, and that lack of type IX collagen is associated with early onset osteoarthritis. Mutations in this gene are associated with osteoarthritis in humans, with multiple epiphyseal dysplasia, 6, a form of chondrodysplasia, and with Stickler syndrome, a disease characterized by ophthalmic, orofacial, articular, and auditory defects. Two transcript variants that encode different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(12839) collagen, type IX, alpha 1
Rat(305104) collagen, type IX, alpha 1
Zebrafish(406548) collagen, type IX, alpha 1
dog(481873) collagen, type IX, alpha 1
cow(282195) collagen, type IX, alpha 1
domestic cat(101086148) collagen, type IX, alpha 1
chicken(771873) collagen, type IX, alpha 1
sheep(101102992) collagen, type IX, alpha 1
domestic guinea pig(100723407) collagen, type IX, alpha 1
naked mole-rat(101726107) collagen, type IX, alpha 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001851 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001851 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001851 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007740 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007740 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007740 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001851 Rosetta Predictions human pricing
NM_078485 Rosetta Predictions human pricing
XM_001069096 Rosetta Predictions rat pricing
XM_223124 Rosetta Predictions rat pricing
NM_007740 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001851 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103217 predicted 2056
2 SASI_Hs01_00103218 predicted 2429
3 SASI_Hs01_00103219 predicted 1883
4 SASI_Hs01_00103221 predicted 2899
5 SASI_Hs01_00103222 predicted 2462
6 SASI_Hs01_00103223 predicted 2245
7 SASI_Hs01_00103224 predicted 2219
8 SASI_Hs01_00103225 predicted 1332
9 SASI_Hs01_00103226 predicted 2680
10 SASI_Hs02_00332670 predicted 1630
11 SASI_Hs01_00103220 predicted 3415
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_078485 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240012 predicted 1339
2 SASI_Hs01_00240013 predicted 1710
3 SASI_Hs01_00240014 predicted 1161
4 SASI_Hs01_00240016 predicted 2184
5 SASI_Hs01_00240017 predicted 1752
6 SASI_Hs01_00240018 predicted 1520
7 SASI_Hs01_00240019 predicted 1496
8 SASI_Hs01_00240020 predicted 616
9 SASI_Hs01_00240021 predicted 1959
10 SASI_Hs02_00362170 predicted 904
11 SASI_Hs01_00240015 predicted 2696
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069096 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00326872 predicted 781
2 SASI_Rn02_00326873 predicted 755
3 SASI_Rn02_00326874 predicted 2649
4 SASI_Rn02_00326875 predicted 400
5 SASI_Rn02_00326876 predicted 233
6 SASI_Rn02_00326877 predicted 597
7 SASI_Rn02_00326878 predicted 406
8 SASI_Rn02_00326879 predicted 680
9 SASI_Rn02_00326880 predicted 1967
10 SASI_Rn02_00326881 predicted 1856
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223124 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381149 predicted 780
2 SASI_Rn02_00381150 predicted 755
3 SASI_Rn02_00381151 predicted 395
4 SASI_Rn02_00381152 predicted 231
5 SASI_Rn02_00381153 predicted 2189
6 SASI_Rn02_00381154 predicted 593
7 SASI_Rn02_00381155 predicted 411
8 SASI_Rn02_00381156 predicted 1971
9 SASI_Rn02_00381157 predicted 1856
10 SASI_Rn02_00381158 predicted 2197
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007740 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146290 predicted 593
2 SASI_Mm01_00146291 predicted 394
3 SASI_Mm02_00312339 predicted 781
4 SASI_Mm01_00146292 predicted 1293
5 SASI_Mm01_00146293 predicted 1202
6 SASI_Mm01_00146294 predicted 417
7 SASI_Mm02_00312340 predicted 582
8 SASI_Mm01_00146297 predicted 662
9 SASI_Mm01_00146298 predicted 531
10 SASI_Mm01_00146299 predicted 2433
11 SASI_Mm01_00146295 predicted 2650
12 SASI_Mm01_00146296 predicted 1585
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001851
COL9A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type IX, alpha 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371969    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001851.4-3295s21c1
Sequence:CCGGCCTCAGTTGCAGTAGTTATTTCTCGAGAAATAACTACTGCAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001851.4-3038s21c1
Sequence:CCGGGTATTACCTTCAGTATGATTACTCGAGTAATCATACTGAAGGTAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001851.2-238s1c1
Sequence:CCGGTCCCTGTCAATTCCAATTCTACTCGAGTAGAATTGGAATTGACAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001851.2-2435s1c1
Sequence:CCGGGCAGGTTTGCATGAGAGTCATCTCGAGATGACTCTCATGCAAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001851.2-3084s1c1
Sequence:CCGGGCTATTCAGTAAGTTCTCTTTCTCGAGAAAGAGAACTTACTGAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001851.2-240s1c1
Sequence:CCGGCCTGTCAATTCCAATTCTAATCTCGAGATTAGAATTGGAATTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001851.2-402s1c1
Sequence:CCGGGCTTACAAGTTGGGAAATAATCTCGAGATTATTTCCCAACTTGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001851
COL9A1 MISSION shRNA shRNA Plasmid DNA
collagen, type IX, alpha 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371969    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001851.4-3295s21c1
Sequence:CCGGCCTCAGTTGCAGTAGTTATTTCTCGAGAAATAACTACTGCAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001851.4-3038s21c1
Sequence:CCGGGTATTACCTTCAGTATGATTACTCGAGTAATCATACTGAAGGTAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001851.2-238s1c1
Sequence:CCGGTCCCTGTCAATTCCAATTCTACTCGAGTAGAATTGGAATTGACAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001851.2-2435s1c1
Sequence:CCGGGCAGGTTTGCATGAGAGTCATCTCGAGATGACTCTCATGCAAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001851.2-3084s1c1
Sequence:CCGGGCTATTCAGTAAGTTCTCTTTCTCGAGAAAGAGAACTTACTGAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001851.2-240s1c1
Sequence:CCGGCCTGTCAATTCCAATTCTAATCTCGAGATTAGAATTGGAATTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001851.2-402s1c1
Sequence:CCGGGCTTACAAGTTGGGAAATAATCTCGAGATTATTTCCCAACTTGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001851
COL9A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type IX, alpha 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371969    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001851.4-3295s21c1
Sequence:CCGGCCTCAGTTGCAGTAGTTATTTCTCGAGAAATAACTACTGCAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001851.4-3038s21c1
Sequence:CCGGGTATTACCTTCAGTATGATTACTCGAGTAATCATACTGAAGGTAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001851.2-238s1c1
Sequence:CCGGTCCCTGTCAATTCCAATTCTACTCGAGTAGAATTGGAATTGACAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001851.2-2435s1c1
Sequence:CCGGGCAGGTTTGCATGAGAGTCATCTCGAGATGACTCTCATGCAAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001851.2-3084s1c1
Sequence:CCGGGCTATTCAGTAAGTTCTCTTTCTCGAGAAAGAGAACTTACTGAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001851.2-240s1c1
Sequence:CCGGCCTGTCAATTCCAATTCTAATCTCGAGATTAGAATTGGAATTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001851.2-402s1c1
Sequence:CCGGGCTTACAAGTTGGGAAATAATCTCGAGATTATTTCCCAACTTGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007740
COL9A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type IX, alpha 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007740.2-3043s1c1
Sequence:CCGGGCTACTTGACAATCAGATTTACTCGAGTAAATCTGATTGTCAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007740.2-599s1c1
Sequence:CCGGCCAAACAAAGTCTGTCGCATTCTCGAGAATGCGACAGACTTTGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007740.2-598s1c1
Sequence:CCGGGCCAAACAAAGTCTGTCGCATCTCGAGATGCGACAGACTTTGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007740.2-237s1c1
Sequence:CCGGCGTGCAAGATTTCCTGCCAATCTCGAGATTGGCAGGAAATCTTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007740.2-419s1c1
Sequence:CCGGGCTGGGAAGTAATGTAGACTTCTCGAGAAGTCTACATTACTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007740
COL9A1 MISSION shRNA shRNA Plasmid DNA
collagen, type IX, alpha 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007740.2-3043s1c1
Sequence:CCGGGCTACTTGACAATCAGATTTACTCGAGTAAATCTGATTGTCAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007740.2-599s1c1
Sequence:CCGGCCAAACAAAGTCTGTCGCATTCTCGAGAATGCGACAGACTTTGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007740.2-598s1c1
Sequence:CCGGGCCAAACAAAGTCTGTCGCATCTCGAGATGCGACAGACTTTGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007740.2-237s1c1
Sequence:CCGGCGTGCAAGATTTCCTGCCAATCTCGAGATTGGCAGGAAATCTTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007740.2-419s1c1
Sequence:CCGGGCTGGGAAGTAATGTAGACTTCTCGAGAAGTCTACATTACTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007740
COL9A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type IX, alpha 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007740.2-3043s1c1
Sequence:CCGGGCTACTTGACAATCAGATTTACTCGAGTAAATCTGATTGTCAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007740.2-599s1c1
Sequence:CCGGCCAAACAAAGTCTGTCGCATTCTCGAGAATGCGACAGACTTTGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007740.2-598s1c1
Sequence:CCGGGCCAAACAAAGTCTGTCGCATCTCGAGATGCGACAGACTTTGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007740.2-237s1c1
Sequence:CCGGCGTGCAAGATTTCCTGCCAATCTCGAGATTGGCAGGAAATCTTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007740.2-419s1c1
Sequence:CCGGGCTGGGAAGTAATGTAGACTTCTCGAGAAGTCTACATTACTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks