EMAIL THIS PAGE TO A FRIEND

COL9A2

collagen, type IX, alpha 2

Synonyms: DJ39G22.4 EDM2 MED STL5
UniProtKB ID: Q14055, B2RMP9
Gene ID:
Human(1298) Summary: This gene encodes one of the three alpha chains of type IX collagen, the major collagen component of hyaline cartilage. Type IX collagen, a heterotrimeric molecule, is usually found in tissues containing type II collagen, a fibrillar collagen. This chain is unusual in that, unlike the other two type IX alpha chains, it contains a covalently attached glycosaminoglycan side chain. Mutations in this gene are associated with multiple epiphyseal dysplasia. [provided by RefSeq, Jul 2008]
Mouse(12840) collagen, type IX, alpha 2
Rat(362584) collagen, type IX, alpha 2
naked mole-rat(101720556) collagen, type IX, alpha 2
domestic guinea pig(100725525) collagen, type IX, alpha 2
sheep(101121906) collagen, type IX, alpha 2
Zebrafish(321212) procollagen, type IX, alpha 2
cow(505942) collagen, type IX, alpha 2
Horse(100009713) collagen, type IX, alpha 2
domestic cat(101090632) collagen, type IX, alpha 2
dog(607609) collagen, type IX, alpha 2
chicken(396524) collagen, type IX, alpha 2
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001852 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001852 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001852 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007741 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007741 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007741 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001852 Rosetta Predictions human pricing
NM_001108675 Rosetta Predictions rat pricing
NM_007741 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001852 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332671 predicted 592
2 SASI_Hs01_00101683 predicted 2358
3 SASI_Hs01_00101684 predicted 573
4 SASI_Hs01_00101685 predicted 2346
5 SASI_Hs01_00101687 predicted 308
6 SASI_Hs01_00101688 predicted 1256
7 SASI_Hs01_00101689 predicted 577
8 SASI_Hs01_00101690 predicted 304
9 SASI_Hs01_00101691 predicted 2591
10 SASI_Hs01_00101692 predicted 2457
11 SASI_Hs01_00101686 predicted 560
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108675 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240965 predicted 2013
2 SASI_Rn02_00240966 predicted 885
3 SASI_Rn02_00240967 predicted 1394
4 SASI_Rn02_00240968 predicted 2643
5 SASI_Rn02_00240969 predicted 1992
6 SASI_Rn02_00240970 predicted 1111
7 SASI_Rn02_00240971 predicted 2521
8 SASI_Rn02_00240972 predicted 892
9 SASI_Rn02_00240973 predicted 872
10 SASI_Rn02_00240974 predicted 595
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007741 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199511 predicted 2621
2 SASI_Mm01_00199512 predicted 878
3 SASI_Mm01_00199513 predicted 1996
4 SASI_Mm01_00199514 predicted 873
5 SASI_Mm01_00199515 predicted 2454
6 SASI_Mm01_00199516 predicted 2011
7 SASI_Mm01_00199517 predicted 2478
8 SASI_Mm01_00199518 predicted 849
9 SASI_Mm01_00199519 predicted 514
10 SASI_Mm01_00199520 predicted 1969
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001852
COL9A2 MISSION shRNA Bacterial Glycerol Stock
collagen, type IX, alpha 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001852.3-2675s1c1
Sequence:CCGGGCCTCCCAGCTCAGTATTTAACTCGAGTTAAATACTGAGCTGGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001852.3-811s1c1
Sequence:CCGGCCCTCATGGATATAAAGGCATCTCGAGATGCCTTTATATCCATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001852.3-977s1c1
Sequence:CCGGCCAGGCATCAACGGCAAGGATCTCGAGATCCTTGCCGTTGATGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001852.3-308s1c1
Sequence:CCGGCCCGGGATTGATGGTTTAACTCTCGAGAGTTAAACCATCAATCCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001852.3-126s21c1
Sequence:CCGGTGCTCGCTCTGGCGCAGATTACTCGAGTAATCTGCGCCAGAGCGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422795    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001852.3-2631s21c1
Sequence:CCGGTGAGGCGGCTATACCCTTAAGCTCGAGCTTAAGGGTATAGCCGCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001852.3-454s21c1
Sequence:CCGGCCTCCCTGGTGAGATTGGAATCTCGAGATTCCAATCTCACCAGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423878    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001852.3-2309s21c1
Sequence:CCGGGTAGAGCACTGATGGGTGAAACTCGAGTTTCACCCATCAGTGCTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001852.3-565s21c1
Sequence:CCGGTCTGGAAGGCAGTGCGGATTTCTCGAGAAATCCGCACTGCCTTCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001852.3-2548s21c1
Sequence:CCGGGACCAATGACTGAGGTCTATGCTCGAGCATAGACCTCAGTCATTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001852
COL9A2 MISSION shRNA shRNA Plasmid DNA
collagen, type IX, alpha 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001852.3-2675s1c1
Sequence:CCGGGCCTCCCAGCTCAGTATTTAACTCGAGTTAAATACTGAGCTGGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001852.3-811s1c1
Sequence:CCGGCCCTCATGGATATAAAGGCATCTCGAGATGCCTTTATATCCATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001852.3-977s1c1
Sequence:CCGGCCAGGCATCAACGGCAAGGATCTCGAGATCCTTGCCGTTGATGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001852.3-308s1c1
Sequence:CCGGCCCGGGATTGATGGTTTAACTCTCGAGAGTTAAACCATCAATCCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001852.3-126s21c1
Sequence:CCGGTGCTCGCTCTGGCGCAGATTACTCGAGTAATCTGCGCCAGAGCGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422795    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001852.3-2631s21c1
Sequence:CCGGTGAGGCGGCTATACCCTTAAGCTCGAGCTTAAGGGTATAGCCGCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001852.3-454s21c1
Sequence:CCGGCCTCCCTGGTGAGATTGGAATCTCGAGATTCCAATCTCACCAGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423878    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001852.3-2309s21c1
Sequence:CCGGGTAGAGCACTGATGGGTGAAACTCGAGTTTCACCCATCAGTGCTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001852.3-565s21c1
Sequence:CCGGTCTGGAAGGCAGTGCGGATTTCTCGAGAAATCCGCACTGCCTTCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001852.3-2548s21c1
Sequence:CCGGGACCAATGACTGAGGTCTATGCTCGAGCATAGACCTCAGTCATTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001852
COL9A2 MISSION shRNA Lentiviral Transduction Particles
collagen, type IX, alpha 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001852.3-2675s1c1
Sequence:CCGGGCCTCCCAGCTCAGTATTTAACTCGAGTTAAATACTGAGCTGGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001852.3-811s1c1
Sequence:CCGGCCCTCATGGATATAAAGGCATCTCGAGATGCCTTTATATCCATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001852.3-977s1c1
Sequence:CCGGCCAGGCATCAACGGCAAGGATCTCGAGATCCTTGCCGTTGATGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001852.3-308s1c1
Sequence:CCGGCCCGGGATTGATGGTTTAACTCTCGAGAGTTAAACCATCAATCCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001852.3-126s21c1
Sequence:CCGGTGCTCGCTCTGGCGCAGATTACTCGAGTAATCTGCGCCAGAGCGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422795    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001852.3-2631s21c1
Sequence:CCGGTGAGGCGGCTATACCCTTAAGCTCGAGCTTAAGGGTATAGCCGCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001852.3-454s21c1
Sequence:CCGGCCTCCCTGGTGAGATTGGAATCTCGAGATTCCAATCTCACCAGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423878    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001852.3-2309s21c1
Sequence:CCGGGTAGAGCACTGATGGGTGAAACTCGAGTTTCACCCATCAGTGCTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001852.3-565s21c1
Sequence:CCGGTCTGGAAGGCAGTGCGGATTTCTCGAGAAATCCGCACTGCCTTCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001852.3-2548s21c1
Sequence:CCGGGACCAATGACTGAGGTCTATGCTCGAGCATAGACCTCAGTCATTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007741
COL9A2 MISSION shRNA Bacterial Glycerol Stock
collagen, type IX, alpha 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112650    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007741.1-2780s1c1
Sequence:CCGGCTATTCTTATTCTCTGGACTTCTCGAGAAGTCCAGAGAATAAGAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007741.1-2271s1c1
Sequence:CCGGCAAGCAATCAATGGCAAGGATCTCGAGATCCTTGCCATTGATTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007741.1-1287s1c1
Sequence:CCGGCCAGGCATTGATGGCAAGGATCTCGAGATCCTTGCCATCAATGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007741.1-2270s1c1
Sequence:CCGGCCAAGCAATCAATGGCAAGGACTCGAGTCCTTGCCATTGATTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007741.1-626s1c1
Sequence:CCGGTGATGGTTTAATGGGAGCCAACTCGAGTTGGCTCCCATTAAACCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007741
COL9A2 MISSION shRNA shRNA Plasmid DNA
collagen, type IX, alpha 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112650    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007741.1-2780s1c1
Sequence:CCGGCTATTCTTATTCTCTGGACTTCTCGAGAAGTCCAGAGAATAAGAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007741.1-2271s1c1
Sequence:CCGGCAAGCAATCAATGGCAAGGATCTCGAGATCCTTGCCATTGATTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007741.1-1287s1c1
Sequence:CCGGCCAGGCATTGATGGCAAGGATCTCGAGATCCTTGCCATCAATGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007741.1-2270s1c1
Sequence:CCGGCCAAGCAATCAATGGCAAGGACTCGAGTCCTTGCCATTGATTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007741.1-626s1c1
Sequence:CCGGTGATGGTTTAATGGGAGCCAACTCGAGTTGGCTCCCATTAAACCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007741
COL9A2 MISSION shRNA Lentiviral Transduction Particles
collagen, type IX, alpha 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112650    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007741.1-2780s1c1
Sequence:CCGGCTATTCTTATTCTCTGGACTTCTCGAGAAGTCCAGAGAATAAGAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007741.1-2271s1c1
Sequence:CCGGCAAGCAATCAATGGCAAGGATCTCGAGATCCTTGCCATTGATTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007741.1-1287s1c1
Sequence:CCGGCCAGGCATTGATGGCAAGGATCTCGAGATCCTTGCCATCAATGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007741.1-2270s1c1
Sequence:CCGGCCAAGCAATCAATGGCAAGGACTCGAGTCCTTGCCATTGATTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007741.1-626s1c1
Sequence:CCGGTGATGGTTTAATGGGAGCCAACTCGAGTTGGCTCCCATTAAACCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks