EMAIL THIS PAGE TO A FRIEND

COL9A3

collagen, type IX, alpha 3

50 Gene Product Result for
Synonyms: DJ885L7.4.1 EDM3 IDD MED
UniProtKB ID: Q14050, Q13681, Q9H4G9, Q9UPE2
Gene ID:
Human(1299) Summary: This gene encodes one of the three alpha chains of type IX collagen, the major collagen component of hyaline cartilage. Type IX collagen, a heterotrimeric molecule, is usually found in tissues containing type II collagen, a fibrillar collagen. Mutations in this gene are associated with multiple epiphyseal dysplasia type 3. [provided by RefSeq, Jan 2010]
Mouse(12841) collagen, type IX, alpha 3
Rat(362285) collagen, type IX, alpha 3
Zebrafish(567110) collagen, type IX, alpha 3
chicken(396242) collagen, type IX, alpha 3
dog(612430) collagen, type IX, alpha 3
cow(789493) collagen, type IX, alpha 3
domestic cat(101081883) collagen, type IX, alpha 3
sheep(101120183) collagen, type IX, alpha 3
domestic guinea pig(100734770) collagen, type IX, alpha 3
naked mole-rat(101707537) collagen, type IX, alpha 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001853 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001853 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001853 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009936 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009936 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009936 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU121911 MISSION® esiRNA esiRNA human COL9A3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001853 Rosetta Predictions human pricing
NM_001108611 Rosetta Predictions rat pricing
NM_009936 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001853 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238815 predicted 1615
2 SASI_Hs01_00238816 predicted 2089
3 SASI_Hs01_00238817 predicted 1991
4 SASI_Hs01_00238818 predicted 2086
5 SASI_Hs01_00238819 predicted 1615
6 SASI_Hs01_00238821 predicted 1602
7 SASI_Hs01_00238822 predicted 2073
8 SASI_Hs01_00238823 predicted 1641
9 SASI_Hs01_00238824 predicted 2077
10 SASI_Hs02_00332672 predicted 1639
11 SASI_Hs01_00238820 predicted 2276
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108611 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240339 predicted 1345
2 SASI_Rn02_00240340 predicted 1238
3 SASI_Rn02_00240341 predicted 1291
4 SASI_Rn02_00240342 predicted 741
5 SASI_Rn02_00240343 predicted 1461
6 SASI_Rn02_00240344 predicted 1395
7 SASI_Rn02_00240345 predicted 1374
8 SASI_Rn02_00240346 predicted 1287
9 SASI_Rn02_00240347 predicted 1360
10 SASI_Rn02_00240348 predicted 1449
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009936 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025934 predicted 2414
2 SASI_Mm01_00025935 predicted 2508
3 SASI_Mm01_00025937 predicted 2377
4 SASI_Mm01_00025938 predicted 2461
5 SASI_Mm01_00025939 predicted 2385
6 SASI_Mm01_00025940 predicted 2425
7 SASI_Mm01_00025941 predicted 938
8 SASI_Mm01_00025942 predicted 2487
9 SASI_Mm01_00025943 predicted 2266
10 SASI_Mm02_00317482 predicted 1585
11 SASI_Mm01_00025936 predicted 2427
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001853
COL9A3 MISSION shRNA Bacterial Glycerol Stock
collagen, type IX, alpha 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001853.3-1313s21c1
Sequence:CCGGCTAAGGGAGACCAGGGTATTGCTCGAGCAATACCCTGGTCTCCCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371879    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001853.3-2096s21c1
Sequence:CCGGAGCACAGTGGACGGTCATGAACTCGAGTTCATGACCGTCCACTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001853.3-2038s21c1
Sequence:CCGGTCAGGCTCTCGAAGCTCATAACTCGAGTTATGAGCTTCGAGAGCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116427    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001853.2-2302s1c1
Sequence:CCGGCCCAGCATTTGAGAGAAGGTACTCGAGTACCTTCTCTCAAATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001853.2-540s1c1
Sequence:CCGGTGACCTTCAGTGCCCAAGTATCTCGAGATACTTGGGCACTGAAGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001853.2-2026s1c1
Sequence:CCGGGCCTGCCAAGGAGCCGTGTTACTCGAGTAACACGGCTCCTTGGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001853.2-937s1c1
Sequence:CCGGCCGGGCAAGGACGGCCAGAATCTCGAGATTCTGGCCGTCCTTGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001853.2-1630s1c1
Sequence:CCGGAGCGAACAAATTGCACAGTTACTCGAGTAACTGTGCAATTTGTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001853
COL9A3 MISSION shRNA shRNA Plasmid DNA
collagen, type IX, alpha 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001853.3-1313s21c1
Sequence:CCGGCTAAGGGAGACCAGGGTATTGCTCGAGCAATACCCTGGTCTCCCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371879    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001853.3-2096s21c1
Sequence:CCGGAGCACAGTGGACGGTCATGAACTCGAGTTCATGACCGTCCACTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001853.3-2038s21c1
Sequence:CCGGTCAGGCTCTCGAAGCTCATAACTCGAGTTATGAGCTTCGAGAGCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116427    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001853.2-2302s1c1
Sequence:CCGGCCCAGCATTTGAGAGAAGGTACTCGAGTACCTTCTCTCAAATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001853.2-540s1c1
Sequence:CCGGTGACCTTCAGTGCCCAAGTATCTCGAGATACTTGGGCACTGAAGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001853.2-2026s1c1
Sequence:CCGGGCCTGCCAAGGAGCCGTGTTACTCGAGTAACACGGCTCCTTGGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001853.2-937s1c1
Sequence:CCGGCCGGGCAAGGACGGCCAGAATCTCGAGATTCTGGCCGTCCTTGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001853.2-1630s1c1
Sequence:CCGGAGCGAACAAATTGCACAGTTACTCGAGTAACTGTGCAATTTGTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001853
COL9A3 MISSION shRNA Lentiviral Transduction Particles
collagen, type IX, alpha 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001853.3-1313s21c1
Sequence:CCGGCTAAGGGAGACCAGGGTATTGCTCGAGCAATACCCTGGTCTCCCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371879    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001853.3-2096s21c1
Sequence:CCGGAGCACAGTGGACGGTCATGAACTCGAGTTCATGACCGTCCACTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001853.3-2038s21c1
Sequence:CCGGTCAGGCTCTCGAAGCTCATAACTCGAGTTATGAGCTTCGAGAGCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116427    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001853.2-2302s1c1
Sequence:CCGGCCCAGCATTTGAGAGAAGGTACTCGAGTACCTTCTCTCAAATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001853.2-540s1c1
Sequence:CCGGTGACCTTCAGTGCCCAAGTATCTCGAGATACTTGGGCACTGAAGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001853.2-2026s1c1
Sequence:CCGGGCCTGCCAAGGAGCCGTGTTACTCGAGTAACACGGCTCCTTGGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001853.2-937s1c1
Sequence:CCGGCCGGGCAAGGACGGCCAGAATCTCGAGATTCTGGCCGTCCTTGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001853.2-1630s1c1
Sequence:CCGGAGCGAACAAATTGCACAGTTACTCGAGTAACTGTGCAATTTGTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009936
COL9A3 MISSION shRNA Bacterial Glycerol Stock
collagen, type IX, alpha 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000348124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009936.2-2423s21c1
Sequence:CCGGCTATGATAGACTACCAATAAACTCGAGTTTATTGGTAGTCTATCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009936.2-1902s21c1
Sequence:CCGGGTACCTGGCATCAGCAAAGATCTCGAGATCTTTGCTGATGCCAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009936.2-153s21c1
Sequence:CCGGCCCGGCAAGGATGGCATTGATCTCGAGATCAATGCCATCCTTGCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009936.2-1617s21c1
Sequence:CCGGGGTATGATCAGTGAGCAAATTCTCGAGAATTTGCTCACTGATCATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009936.1-2084s1c1
Sequence:CCGGGCTCCATATTTCCTACTGAAACTCGAGTTTCAGTAGGAAATATGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009936.1-693s1c1
Sequence:CCGGCCACGAGGATTAAGAGGACTTCTCGAGAAGTCCTCTTAATCCTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009936.1-1604s1c1
Sequence:CCGGCAGTGAGCAAATTGCACAGTTCTCGAGAACTGTGCAATTTGCTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009936.1-132s1c1
Sequence:CCGGCCCGGCAAGGATGGCATTGATCTCGAGATCAATGCCATCCTTGCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009936.1-1881s1c1
Sequence:CCGGGTACCTGGCATCAGCAAAGATCTCGAGATCTTTGCTGATGCCAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009936
COL9A3 MISSION shRNA shRNA Plasmid DNA
collagen, type IX, alpha 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000348124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009936.2-2423s21c1
Sequence:CCGGCTATGATAGACTACCAATAAACTCGAGTTTATTGGTAGTCTATCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009936.2-1902s21c1
Sequence:CCGGGTACCTGGCATCAGCAAAGATCTCGAGATCTTTGCTGATGCCAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009936.2-153s21c1
Sequence:CCGGCCCGGCAAGGATGGCATTGATCTCGAGATCAATGCCATCCTTGCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009936.2-1617s21c1
Sequence:CCGGGGTATGATCAGTGAGCAAATTCTCGAGAATTTGCTCACTGATCATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009936.1-2084s1c1
Sequence:CCGGGCTCCATATTTCCTACTGAAACTCGAGTTTCAGTAGGAAATATGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009936.1-693s1c1
Sequence:CCGGCCACGAGGATTAAGAGGACTTCTCGAGAAGTCCTCTTAATCCTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009936.1-1604s1c1
Sequence:CCGGCAGTGAGCAAATTGCACAGTTCTCGAGAACTGTGCAATTTGCTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009936.1-132s1c1
Sequence:CCGGCCCGGCAAGGATGGCATTGATCTCGAGATCAATGCCATCCTTGCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009936.1-1881s1c1
Sequence:CCGGGTACCTGGCATCAGCAAAGATCTCGAGATCTTTGCTGATGCCAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009936
COL9A3 MISSION shRNA Lentiviral Transduction Particles
collagen, type IX, alpha 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000348124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009936.2-2423s21c1
Sequence:CCGGCTATGATAGACTACCAATAAACTCGAGTTTATTGGTAGTCTATCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009936.2-1902s21c1
Sequence:CCGGGTACCTGGCATCAGCAAAGATCTCGAGATCTTTGCTGATGCCAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009936.2-153s21c1
Sequence:CCGGCCCGGCAAGGATGGCATTGATCTCGAGATCAATGCCATCCTTGCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009936.2-1617s21c1
Sequence:CCGGGGTATGATCAGTGAGCAAATTCTCGAGAATTTGCTCACTGATCATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009936.1-2084s1c1
Sequence:CCGGGCTCCATATTTCCTACTGAAACTCGAGTTTCAGTAGGAAATATGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009936.1-693s1c1
Sequence:CCGGCCACGAGGATTAAGAGGACTTCTCGAGAAGTCCTCTTAATCCTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009936.1-1604s1c1
Sequence:CCGGCAGTGAGCAAATTGCACAGTTCTCGAGAACTGTGCAATTTGCTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009936.1-132s1c1
Sequence:CCGGCCCGGCAAGGATGGCATTGATCTCGAGATCAATGCCATCCTTGCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009936.1-1881s1c1
Sequence:CCGGGTACCTGGCATCAGCAAAGATCTCGAGATCTTTGCTGATGCCAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks