EMAIL THIS PAGE TO A FRIEND

COLCA1

colorectal cancer associated 1

52 Gene Product Result for
Synonyms: C11orf92 CASC12
Species: Human COLCA1(399948)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207429 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207429 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207429 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU045191 MISSION® esiRNA esiRNA human AP002448.3-201 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207429 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207429 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180517 predicted 2682
2 SASI_Hs01_00180518 predicted 2641
3 SASI_Hs01_00180519 predicted 2988
4 SASI_Hs01_00180520 predicted 2491
5 SASI_Hs01_00180521 predicted 2880
6 SASI_Hs01_00180522 predicted 2990
7 SASI_Hs01_00180523 predicted 2685
8 SASI_Hs01_00180524 predicted 2763
9 SASI_Hs01_00180525 predicted 2953
10 SASI_Hs01_00180526 predicted 2758
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207429
COLCA1 MISSION shRNA Bacterial Glycerol Stock
colorectal cancer associated 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207429.1-488s1c1
Sequence:CCGGCTGGTTTGTAGCTCAACATTACTCGAGTAATGTTGAGCTACAAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207429.1-222s1c1
Sequence:CCGGCTTGACAACACCATTGAAGATCTCGAGATCTTCAATGGTGTTGTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207429.1-373s1c1
Sequence:CCGGGCTTCTGTGTTGGCCTTGTTTCTCGAGAAACAAGGCCAACACAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142872    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207429.1-363s1c1
Sequence:CCGGCTTTATGGGTGCTTCTGTGTTCTCGAGAACACAGAAGCACCCATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207429.1-172s1c1
Sequence:CCGGCCTCTCCTTTCATGTGGAGATCTCGAGATCTCCACATGAAAGGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207429.1-331s1c1
Sequence:CCGGGCAAGGATCTCTTTGTCCCAACTCGAGTTGGGACAAAGAGATCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207429.1-173s1c1
Sequence:CCGGCTCTCCTTTCATGTGGAGATGCTCGAGCATCTCCACATGAAAGGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140046    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207429.1-477s1c1
Sequence:CCGGGAAGCTTCCCTCTGGTTTGTACTCGAGTACAAACCAGAGGGAAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140426    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207429.1-240s1c1
Sequence:CCGGGATGATGCTGACGATCAGCTACTCGAGTAGCTGATCGTCAGCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207429.1-473s1c1
Sequence:CCGGGAAAGAAGCTTCCCTCTGGTTCTCGAGAACCAGAGGGAAGCTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207429.1-419s1c1
Sequence:CCGGGCTGGCTAGCGATTTCAGAAACTCGAGTTTCTGAAATCGCTAGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142873    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207429.2-4751s1c1
Sequence:CCGGCCTTCTTATACCCAGTCCATACTCGAGTATGGACTGGGTATAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207429
COLCA1 MISSION shRNA shRNA Plasmid DNA
colorectal cancer associated 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207429.1-488s1c1
Sequence:CCGGCTGGTTTGTAGCTCAACATTACTCGAGTAATGTTGAGCTACAAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207429.1-222s1c1
Sequence:CCGGCTTGACAACACCATTGAAGATCTCGAGATCTTCAATGGTGTTGTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207429.1-373s1c1
Sequence:CCGGGCTTCTGTGTTGGCCTTGTTTCTCGAGAAACAAGGCCAACACAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142872    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207429.1-363s1c1
Sequence:CCGGCTTTATGGGTGCTTCTGTGTTCTCGAGAACACAGAAGCACCCATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207429.1-172s1c1
Sequence:CCGGCCTCTCCTTTCATGTGGAGATCTCGAGATCTCCACATGAAAGGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207429.1-331s1c1
Sequence:CCGGGCAAGGATCTCTTTGTCCCAACTCGAGTTGGGACAAAGAGATCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207429.1-173s1c1
Sequence:CCGGCTCTCCTTTCATGTGGAGATGCTCGAGCATCTCCACATGAAAGGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140046    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207429.1-477s1c1
Sequence:CCGGGAAGCTTCCCTCTGGTTTGTACTCGAGTACAAACCAGAGGGAAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140426    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207429.1-240s1c1
Sequence:CCGGGATGATGCTGACGATCAGCTACTCGAGTAGCTGATCGTCAGCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207429.1-473s1c1
Sequence:CCGGGAAAGAAGCTTCCCTCTGGTTCTCGAGAACCAGAGGGAAGCTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207429.1-419s1c1
Sequence:CCGGGCTGGCTAGCGATTTCAGAAACTCGAGTTTCTGAAATCGCTAGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142873    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207429.2-4751s1c1
Sequence:CCGGCCTTCTTATACCCAGTCCATACTCGAGTATGGACTGGGTATAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207429
COLCA1 MISSION shRNA Lentiviral Transduction Particles
colorectal cancer associated 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207429.1-488s1c1
Sequence:CCGGCTGGTTTGTAGCTCAACATTACTCGAGTAATGTTGAGCTACAAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207429.1-222s1c1
Sequence:CCGGCTTGACAACACCATTGAAGATCTCGAGATCTTCAATGGTGTTGTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207429.1-373s1c1
Sequence:CCGGGCTTCTGTGTTGGCCTTGTTTCTCGAGAAACAAGGCCAACACAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142872    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207429.1-363s1c1
Sequence:CCGGCTTTATGGGTGCTTCTGTGTTCTCGAGAACACAGAAGCACCCATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207429.1-172s1c1
Sequence:CCGGCCTCTCCTTTCATGTGGAGATCTCGAGATCTCCACATGAAAGGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207429.1-331s1c1
Sequence:CCGGGCAAGGATCTCTTTGTCCCAACTCGAGTTGGGACAAAGAGATCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207429.1-173s1c1
Sequence:CCGGCTCTCCTTTCATGTGGAGATGCTCGAGCATCTCCACATGAAAGGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140046    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207429.1-477s1c1
Sequence:CCGGGAAGCTTCCCTCTGGTTTGTACTCGAGTACAAACCAGAGGGAAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140426    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207429.1-240s1c1
Sequence:CCGGGATGATGCTGACGATCAGCTACTCGAGTAGCTGATCGTCAGCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207429.1-473s1c1
Sequence:CCGGGAAAGAAGCTTCCCTCTGGTTCTCGAGAACCAGAGGGAAGCTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207429.1-419s1c1
Sequence:CCGGGCTGGCTAGCGATTTCAGAAACTCGAGTTTCTGAAATCGCTAGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142873    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207429.2-4751s1c1
Sequence:CCGGCCTTCTTATACCCAGTCCATACTCGAGTATGGACTGGGTATAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks