EMAIL THIS PAGE TO A FRIEND

COLCA2

colorectal cancer associated 2

40 Gene Product Result for
Synonyms: C11orf93 CASC13
Species: Human COLCA2(120376)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001136105 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001136105 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001136105 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU102591 MISSION® esiRNA esiRNA human AP002448.3-202 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001718669 Rosetta Predictions human pricing
XM_071712 Rosetta Predictions human pricing
XM_943506 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001718669 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00425528 predicted 1343
2 SASI_Hs02_00425529 predicted 1216
3 SASI_Hs02_00425530 predicted 863
4 SASI_Hs02_00425531 predicted 1277
5 SASI_Hs02_00425532 predicted 911
6 SASI_Hs02_00425533 predicted 1387
7 SASI_Hs02_00425534 predicted 928
8 SASI_Hs02_00425535 predicted 1076
9 SASI_Hs02_00425536 predicted 1033
10 SASI_Hs02_00425537 predicted 931
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_071712 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00478796 predicted 1544
2 SASI_Hs02_00478797 predicted 989
3 SASI_Hs02_00478798 predicted 1586
4 SASI_Hs02_00478799 predicted 964
5 SASI_Hs01_00296981 predicted 1138
6 SASI_Hs01_00296982 predicted 1281
7 SASI_Hs01_00296984 predicted 1131
8 SASI_Hs02_00478800 predicted 1551
9 SASI_Hs02_00478801 predicted 1553
10 SASI_Hs02_00478802 predicted 1033
11 SASI_Hs01_00296975 predicted 1447
12 SASI_Hs01_00296976 predicted 1625
13 SASI_Hs01_00296977 predicted 1277
14 SASI_Hs01_00296978 predicted 1700
15 SASI_Hs01_00296979 predicted 1325
16 SASI_Hs01_00296980 predicted 1244
17 SASI_Hs01_00296983 predicted 1449
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_943506 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00485966 predicted 1548
2 SASI_Hs02_00485967 predicted 989
3 SASI_Hs02_00485968 predicted 1592
4 SASI_Hs02_00485969 predicted 958
5 SASI_Hs02_00485970 predicted 1138
6 SASI_Hs02_00485971 predicted 1278
7 SASI_Hs02_00485972 predicted 1137
8 SASI_Hs02_00485973 predicted 1547
9 SASI_Hs02_00485974 predicted 1554
10 SASI_Hs02_00485975 predicted 1034
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001136105
COLCA2 MISSION shRNA Bacterial Glycerol Stock
colorectal cancer associated 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136105.1-1168s21c1
Sequence:CCGGCCGCCACCAGTGATTTCTATACTCGAGTATAGAAATCACTGGTGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136105.1-891s21c1
Sequence:CCGGGGCTCCTTAGACTACAGTTACCTCGAGGTAACTGTAGTCTAAGGAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284157    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136105.1-1241s21c1
Sequence:CCGGCAGAACATGGCATGGGTATATCTCGAGATATACCCATGCCATGTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136105.1-934s21c1
Sequence:CCGGATGCTCCAGAGAATTACAATTCTCGAGAATTGTAATTCTCTGGAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136105.1-1203s21c1
Sequence:CCGGTGTGACATCTGCTATAGTTAACTCGAGTTAACTATAGCAGATGTCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001136105
COLCA2 MISSION shRNA shRNA Plasmid DNA
colorectal cancer associated 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136105.1-1168s21c1
Sequence:CCGGCCGCCACCAGTGATTTCTATACTCGAGTATAGAAATCACTGGTGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136105.1-891s21c1
Sequence:CCGGGGCTCCTTAGACTACAGTTACCTCGAGGTAACTGTAGTCTAAGGAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284157    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136105.1-1241s21c1
Sequence:CCGGCAGAACATGGCATGGGTATATCTCGAGATATACCCATGCCATGTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136105.1-934s21c1
Sequence:CCGGATGCTCCAGAGAATTACAATTCTCGAGAATTGTAATTCTCTGGAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136105.1-1203s21c1
Sequence:CCGGTGTGACATCTGCTATAGTTAACTCGAGTTAACTATAGCAGATGTCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001136105
COLCA2 MISSION shRNA Lentiviral Transduction Particles
colorectal cancer associated 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136105.1-1168s21c1
Sequence:CCGGCCGCCACCAGTGATTTCTATACTCGAGTATAGAAATCACTGGTGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136105.1-891s21c1
Sequence:CCGGGGCTCCTTAGACTACAGTTACCTCGAGGTAACTGTAGTCTAAGGAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284157    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136105.1-1241s21c1
Sequence:CCGGCAGAACATGGCATGGGTATATCTCGAGATATACCCATGCCATGTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136105.1-934s21c1
Sequence:CCGGATGCTCCAGAGAATTACAATTCTCGAGAATTGTAATTCTCTGGAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136105.1-1203s21c1
Sequence:CCGGTGTGACATCTGCTATAGTTAACTCGAGTTAACTATAGCAGATGTCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)