EMAIL THIS PAGE TO A FRIEND

COLEC10

collectin sub-family member 10 (C-type lectin)

59 Gene Product Result for
Synonyms: CLL1
UniProtKB ID: Q9Y6Z7, Q3SYH6, Q6UW19
Gene ID:
Human(10584) Summary: This gene encodes a member of the C-lectin family, proteins that possess collagen-like sequences and carbohydrate recognition domains. The other members of this family are secreted proteins and bind to carbohydrate antigens on microorganisms facilitating their recognition and removal. This gene product is a cytosolic protein, a characteristic that suggests that it may have different biological functions than other C-lectins. [provided by RefSeq, Jul 2008]
Mouse(239447) collectin sub-family member 10
Rat(299928) collectin sub-family member 10 (C-type lectin)
chicken(420281) collectin sub-family member 10 (C-type lectin)
cow(512030) collectin sub-family member 10 (C-type lectin)
domestic cat(101097131) collectin sub-family member 10 (C-type lectin)
dog(608976) collectin sub-family member 10 (C-type lectin)
domestic guinea pig(100715285) collectin sub-family member 10 (C-type lectin)
naked mole-rat(101709852) collectin sub-family member 10 (C-type lectin)
sheep(101114116) collectin sub-family member 10 (C-type lectin)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006438 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006438 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006438 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173422 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173422 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173422 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU036951 MISSION® esiRNA esiRNA human COLEC10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006438 Rosetta Predictions human pricing
NM_001130541 Rosetta Predictions rat pricing
NM_173422 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006438 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074924 predicted 938
2 SASI_Hs01_00074925 predicted 912
3 SASI_Hs02_00341571 predicted 445
4 SASI_Hs02_00341572 predicted 721
5 SASI_Hs02_00341573 predicted 994
6 SASI_Hs01_00074926 predicted 865
7 SASI_Hs01_00074928 predicted 796
8 SASI_Hs01_00074929 predicted 993
9 SASI_Hs01_00074930 predicted 432
10 SASI_Hs01_00074931 predicted 511
11 SASI_Hs01_00074927 predicted 641
12 SASI_Hs01_00074932 predicted 578
13 SASI_Hs01_00074933 predicted 484
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130541 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255589 predicted 579
2 SASI_Rn02_00255590 predicted 411
3 SASI_Rn02_00255591 predicted 659
4 SASI_Rn02_00255592 predicted 562
5 SASI_Rn02_00255593 predicted 1032
6 SASI_Rn02_00255594 predicted 670
7 SASI_Rn02_00255595 predicted 399
8 SASI_Rn02_00255596 predicted 374
9 SASI_Rn02_00255597 predicted 1110
10 SASI_Rn02_00255598 predicted 618
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173422 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023830 predicted 411
2 SASI_Mm01_00023831 predicted 650
3 SASI_Mm01_00023832 predicted 411
4 SASI_Mm02_00345301 predicted 1091
5 SASI_Mm01_00023833 predicted 668
6 SASI_Mm01_00023834 predicted 1105
7 SASI_Mm02_00345302 predicted 422
8 SASI_Mm01_00023835 predicted 244
9 SASI_Mm01_00023836 predicted 1094
10 SASI_Mm01_00023838 predicted 1008
11 SASI_Mm01_00023829 predicted 608
12 SASI_Mm01_00023837 predicted 228
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006438
COLEC10 MISSION shRNA Bacterial Glycerol Stock
collectin sub-family member 10 (C-type lectin)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006438.3-457s21c1
Sequence:CCGGTTGTGGAAGATACCGGAAATTCTCGAGAATTTCCGGTATCTTCCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006438.3-341s21c1
Sequence:CCGGATGGGAGATCAGGGCAATATTCTCGAGAATATTGCCCTGATCTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006438.3-482s21c1
Sequence:CCGGGGACAACTGGATATTAGTATTCTCGAGAATACTAATATCCAGTTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006438.2-483s1c1
Sequence:CCGGCCGGCTCAAGACATCTATGAACTCGAGTTCATAGATGTCTTGAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006438.2-691s1c1
Sequence:CCGGCGGGTGTTCATTGGCGTGAATCTCGAGATTCACGCCAATGAACACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006438.2-289s1c1
Sequence:CCGGCCGAAAGGAATTAAAGGAGAACTCGAGTTCTCCTTTAATTCCTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006438.2-523s1c1
Sequence:CCGGGCAGGGATTAGGGAAACTGAACTCGAGTTCAGTTTCCCTAATCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006438.2-109s1c1
Sequence:CCGGCAATTTATCCTCCTGGTACTACTCGAGTAGTACCAGGAGGATAAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006438
COLEC10 MISSION shRNA shRNA Plasmid DNA
collectin sub-family member 10 (C-type lectin)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006438.3-457s21c1
Sequence:CCGGTTGTGGAAGATACCGGAAATTCTCGAGAATTTCCGGTATCTTCCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006438.3-341s21c1
Sequence:CCGGATGGGAGATCAGGGCAATATTCTCGAGAATATTGCCCTGATCTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006438.3-482s21c1
Sequence:CCGGGGACAACTGGATATTAGTATTCTCGAGAATACTAATATCCAGTTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006438.2-483s1c1
Sequence:CCGGCCGGCTCAAGACATCTATGAACTCGAGTTCATAGATGTCTTGAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006438.2-691s1c1
Sequence:CCGGCGGGTGTTCATTGGCGTGAATCTCGAGATTCACGCCAATGAACACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006438.2-289s1c1
Sequence:CCGGCCGAAAGGAATTAAAGGAGAACTCGAGTTCTCCTTTAATTCCTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006438.2-523s1c1
Sequence:CCGGGCAGGGATTAGGGAAACTGAACTCGAGTTCAGTTTCCCTAATCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006438.2-109s1c1
Sequence:CCGGCAATTTATCCTCCTGGTACTACTCGAGTAGTACCAGGAGGATAAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006438
COLEC10 MISSION shRNA Lentiviral Transduction Particles
collectin sub-family member 10 (C-type lectin)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006438.3-457s21c1
Sequence:CCGGTTGTGGAAGATACCGGAAATTCTCGAGAATTTCCGGTATCTTCCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006438.3-341s21c1
Sequence:CCGGATGGGAGATCAGGGCAATATTCTCGAGAATATTGCCCTGATCTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006438.3-482s21c1
Sequence:CCGGGGACAACTGGATATTAGTATTCTCGAGAATACTAATATCCAGTTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006438.2-483s1c1
Sequence:CCGGCCGGCTCAAGACATCTATGAACTCGAGTTCATAGATGTCTTGAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006438.2-691s1c1
Sequence:CCGGCGGGTGTTCATTGGCGTGAATCTCGAGATTCACGCCAATGAACACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006438.2-289s1c1
Sequence:CCGGCCGAAAGGAATTAAAGGAGAACTCGAGTTCTCCTTTAATTCCTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006438.2-523s1c1
Sequence:CCGGGCAGGGATTAGGGAAACTGAACTCGAGTTCAGTTTCCCTAATCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006438.2-109s1c1
Sequence:CCGGCAATTTATCCTCCTGGTACTACTCGAGTAGTACCAGGAGGATAAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173422
COLEC10 MISSION shRNA Bacterial Glycerol Stock
collectin sub-family member 10 (C-type lectin)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173422.1-462s1c1
Sequence:CCGGCCGGGAAACTGAAGAGAAATTCTCGAGAATTTCTCTTCAGTTTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173422.1-789s1c1
Sequence:CCGGGTGTCACCTTACCATGTATTTCTCGAGAAATACATGGTAAGGTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173422.1-660s1c1
Sequence:CCGGGCAATATGTGTTCACAGATAACTCGAGTTATCTGTGAACACATATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173422.1-499s1c1
Sequence:CCGGGAGGAGAAGAACTACAGGGAACTCGAGTTCCCTGTAGTTCTTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173422.1-86s1c1
Sequence:CCGGGTCTGGATGTTGATAGTCGATCTCGAGATCGACTATCAACATCCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173422
COLEC10 MISSION shRNA shRNA Plasmid DNA
collectin sub-family member 10 (C-type lectin)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173422.1-462s1c1
Sequence:CCGGCCGGGAAACTGAAGAGAAATTCTCGAGAATTTCTCTTCAGTTTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173422.1-789s1c1
Sequence:CCGGGTGTCACCTTACCATGTATTTCTCGAGAAATACATGGTAAGGTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173422.1-660s1c1
Sequence:CCGGGCAATATGTGTTCACAGATAACTCGAGTTATCTGTGAACACATATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173422.1-499s1c1
Sequence:CCGGGAGGAGAAGAACTACAGGGAACTCGAGTTCCCTGTAGTTCTTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173422.1-86s1c1
Sequence:CCGGGTCTGGATGTTGATAGTCGATCTCGAGATCGACTATCAACATCCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173422
COLEC10 MISSION shRNA Lentiviral Transduction Particles
collectin sub-family member 10 (C-type lectin)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173422.1-462s1c1
Sequence:CCGGCCGGGAAACTGAAGAGAAATTCTCGAGAATTTCTCTTCAGTTTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173422.1-789s1c1
Sequence:CCGGGTGTCACCTTACCATGTATTTCTCGAGAAATACATGGTAAGGTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173422.1-660s1c1
Sequence:CCGGGCAATATGTGTTCACAGATAACTCGAGTTATCTGTGAACACATATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173422.1-499s1c1
Sequence:CCGGGAGGAGAAGAACTACAGGGAACTCGAGTTCCCTGTAGTTCTTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173422.1-86s1c1
Sequence:CCGGGTCTGGATGTTGATAGTCGATCTCGAGATCGACTATCAACATCCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks