EMAIL THIS PAGE TO A FRIEND

COLEC12

collectin sub-family member 12

111 Gene Product Result for
Synonyms: CLP1 NSR2 SCARA4 SRCL
UniProtKB ID: Q5KU26, Q6P9F2, Q8TCR2, Q8WZA4, Q9BY85, Q9BYH7
Gene ID:
Human(81035) Summary: This gene encodes a member of the C-lectin family, proteins that possess collagen-like sequences and carbohydrate recognition domains. This protein is a scavenger receptor, a cell surface glycoprotein that displays several functions associated with host defense. It can bind to carbohydrate antigens on microorganisms, facilitating their recognition and removal. It also mediates the recognition, internalization, and degradation of oxidatively modified low density lipoprotein by vascular endothelial cells. [provided by RefSeq, Oct 2011]
Mouse(140792) collectin sub-family member 12
Rat(361289) collectin sub-family member 12
Zebrafish(558942) collectin sub-family member 12
cow(504741) collectin sub-family member 12
domestic cat(101094054) collectin sub-family member 12
dog(607342) collectin sub-family member 12
chicken(421061) collectin sub-family member 12
domestic guinea pig(100722741) collectin sub-family member 12
naked mole-rat(101720198) collectin sub-family member 12
sheep(101102949) collectin sub-family member 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_130449 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_130449 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_130449 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_130386 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_130386 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_130386 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030781 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030781 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030781 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030781 Rosetta Predictions human pricing
NM_130386 Rosetta Predictions human pricing
NM_001025721 Rosetta Predictions rat pricing
NM_130449 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030781 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039431 predicted 736
2 SASI_Hs01_00039432 predicted 746
3 SASI_Hs01_00039433 predicted 1422
4 SASI_Hs01_00039434 predicted 632
5 SASI_Hs01_00039435 predicted 772
6 SASI_Hs01_00039436 predicted 1146
7 SASI_Hs01_00039437 predicted 637
8 SASI_Hs01_00039438 predicted 881
9 SASI_Hs01_00039439 predicted 290
10 SASI_Hs01_00039440 predicted 1138
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130386 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161559 predicted 736
2 SASI_Hs01_00161560 predicted 744
3 SASI_Hs01_00161561 predicted 1412
4 SASI_Hs01_00161563 predicted 766
5 SASI_Hs01_00161564 predicted 1141
6 SASI_Hs01_00161565 predicted 627
7 SASI_Hs01_00161566 predicted 877
8 SASI_Hs01_00161567 predicted 283
9 SASI_Hs01_00161568 predicted 1131
10 SASI_Hs02_00362708 predicted 381
11 SASI_Hs01_00161562 predicted 627
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025721 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115997 predicted 2286
2 SASI_Rn01_00115998 predicted 2243
3 SASI_Rn01_00116000 predicted 197
4 SASI_Rn01_00116001 predicted 1926
5 SASI_Rn01_00116003 predicted 605
6 SASI_Rn01_00116004 predicted 2252
7 SASI_Rn01_00116005 predicted 258
8 SASI_Rn01_00116006 predicted 1228
9 SASI_Rn02_00203344 predicted 1000
10 SASI_Rn02_00203345 predicted 1164
11 SASI_Rn01_00115999 predicted 646
12 SASI_Rn01_00116002 predicted 1920
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130449 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137831 predicted 2310
2 SASI_Mm01_00137832 predicted 2113
3 SASI_Mm01_00137833 predicted 1345
4 SASI_Mm01_00137834 predicted 319
5 SASI_Mm02_00338253 predicted 649
6 SASI_Mm01_00137836 predicted 615
7 SASI_Mm01_00137837 predicted 669
8 SASI_Mm01_00137838 predicted 930
9 SASI_Mm02_00338254 predicted 1313
10 SASI_Mm02_00338255 predicted 1026
11 SASI_Mm01_00137829 predicted 1915
12 SASI_Mm01_00137830 predicted 635
13 SASI_Mm01_00137835 predicted 2023
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130449
COLEC12 MISSION shRNA Bacterial Glycerol Stock
collectin sub-family member 12
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000308563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130449.2-1081s21c1
Sequence:CCGGGCTGTCAAGTTCAGCCAACTTCTCGAGAAGTTGGCTGAACTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130449.2-1311s21c1
Sequence:CCGGGCAAGACATGATGAGGTCAAACTCGAGTTTGACCTCATCATGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130449.2-3117s21c1
Sequence:CCGGGCACACATATAGGCCACATTTCTCGAGAAATGTGGCCTATATGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130449.2-147s21c1
Sequence:CCGGCGGTTACAAGAGGTTTGGTATCTCGAGATACCAAACCTCTTGTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130449.2-807s21c1
Sequence:CCGGCCAGCGAATTAAGAATGATTTCTCGAGAAATCATTCTTAATTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125869    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130449.1-3089s1c1
Sequence:CCGGGCACACATATAGGCCACATTTCTCGAGAAATGTGGCCTATATGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130449.1-778s1c1
Sequence:CCGGCCAGCGAATTAAGAATGATTTCTCGAGAAATCATTCTTAATTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130449.1-1282s1c1
Sequence:CCGGGCAAGACATGATGAGGTCAAACTCGAGTTTGACCTCATCATGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130449.1-1052s1c1
Sequence:CCGGGCTGTCAAGTTCAGCCAACTTCTCGAGAAGTTGGCTGAACTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130449.1-118s1c1
Sequence:CCGGCGGTTACAAGAGGTTTGGTATCTCGAGATACCAAACCTCTTGTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130449
COLEC12 MISSION shRNA shRNA Plasmid DNA
collectin sub-family member 12
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000308563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130449.2-1081s21c1
Sequence:CCGGGCTGTCAAGTTCAGCCAACTTCTCGAGAAGTTGGCTGAACTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130449.2-1311s21c1
Sequence:CCGGGCAAGACATGATGAGGTCAAACTCGAGTTTGACCTCATCATGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130449.2-3117s21c1
Sequence:CCGGGCACACATATAGGCCACATTTCTCGAGAAATGTGGCCTATATGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130449.2-147s21c1
Sequence:CCGGCGGTTACAAGAGGTTTGGTATCTCGAGATACCAAACCTCTTGTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130449.2-807s21c1
Sequence:CCGGCCAGCGAATTAAGAATGATTTCTCGAGAAATCATTCTTAATTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125869    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130449.1-3089s1c1
Sequence:CCGGGCACACATATAGGCCACATTTCTCGAGAAATGTGGCCTATATGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130449.1-778s1c1
Sequence:CCGGCCAGCGAATTAAGAATGATTTCTCGAGAAATCATTCTTAATTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130449.1-1282s1c1
Sequence:CCGGGCAAGACATGATGAGGTCAAACTCGAGTTTGACCTCATCATGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130449.1-1052s1c1
Sequence:CCGGGCTGTCAAGTTCAGCCAACTTCTCGAGAAGTTGGCTGAACTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130449.1-118s1c1
Sequence:CCGGCGGTTACAAGAGGTTTGGTATCTCGAGATACCAAACCTCTTGTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130449
COLEC12 MISSION shRNA Lentiviral Transduction Particles
collectin sub-family member 12
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000308563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130449.2-1081s21c1
Sequence:CCGGGCTGTCAAGTTCAGCCAACTTCTCGAGAAGTTGGCTGAACTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130449.2-1311s21c1
Sequence:CCGGGCAAGACATGATGAGGTCAAACTCGAGTTTGACCTCATCATGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130449.2-3117s21c1
Sequence:CCGGGCACACATATAGGCCACATTTCTCGAGAAATGTGGCCTATATGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130449.2-147s21c1
Sequence:CCGGCGGTTACAAGAGGTTTGGTATCTCGAGATACCAAACCTCTTGTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130449.2-807s21c1
Sequence:CCGGCCAGCGAATTAAGAATGATTTCTCGAGAAATCATTCTTAATTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125869    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130449.1-3089s1c1
Sequence:CCGGGCACACATATAGGCCACATTTCTCGAGAAATGTGGCCTATATGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130449.1-778s1c1
Sequence:CCGGCCAGCGAATTAAGAATGATTTCTCGAGAAATCATTCTTAATTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130449.1-1282s1c1
Sequence:CCGGGCAAGACATGATGAGGTCAAACTCGAGTTTGACCTCATCATGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130449.1-1052s1c1
Sequence:CCGGGCTGTCAAGTTCAGCCAACTTCTCGAGAAGTTGGCTGAACTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130449.1-118s1c1
Sequence:CCGGCGGTTACAAGAGGTTTGGTATCTCGAGATACCAAACCTCTTGTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130386
VALIDATED
COLEC12 MISSION shRNA Bacterial Glycerol Stock
collectin sub-family member 12
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242621    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_130386.2-2693s21c1
Sequence:CCGGGTCAGTAACCGTGCGATTATACTCGAGTATAATCGCACGGTTACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_130386.2-2374s21c1
Sequence:CCGGTCCAATGTGAAGACGTCAATACTCGAGTATTGACGTCTTCACATTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_130386.2-1701s21c1
Sequence:CCGGCGTGGCGGCAAAGGATCTAAACTCGAGTTTAGATCCTTTGCCGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_130386.2-1225s21c1
Sequence:CCGGAGCTCTTTGAGACGGATATTGCTCGAGCAATATCCGTCTCAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_130386.2-919s21c1
Sequence:CCGGAGCGAATCAAGAACGACTTTCCTCGAGGAAAGTCGTTCTTGATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130386
VALIDATED
COLEC12 MISSION shRNA shRNA Plasmid DNA
collectin sub-family member 12
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242621    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_130386.2-2693s21c1
Sequence:CCGGGTCAGTAACCGTGCGATTATACTCGAGTATAATCGCACGGTTACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_130386.2-2374s21c1
Sequence:CCGGTCCAATGTGAAGACGTCAATACTCGAGTATTGACGTCTTCACATTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_130386.2-1701s21c1
Sequence:CCGGCGTGGCGGCAAAGGATCTAAACTCGAGTTTAGATCCTTTGCCGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_130386.2-1225s21c1
Sequence:CCGGAGCTCTTTGAGACGGATATTGCTCGAGCAATATCCGTCTCAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_130386.2-919s21c1
Sequence:CCGGAGCGAATCAAGAACGACTTTCCTCGAGGAAAGTCGTTCTTGATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130386
VALIDATED
COLEC12 MISSION shRNA Lentiviral Transduction Particles
collectin sub-family member 12
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242621    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_130386.2-2693s21c1
Sequence:CCGGGTCAGTAACCGTGCGATTATACTCGAGTATAATCGCACGGTTACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_130386.2-2374s21c1
Sequence:CCGGTCCAATGTGAAGACGTCAATACTCGAGTATTGACGTCTTCACATTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_130386.2-1701s21c1
Sequence:CCGGCGTGGCGGCAAAGGATCTAAACTCGAGTTTAGATCCTTTGCCGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_130386.2-1225s21c1
Sequence:CCGGAGCTCTTTGAGACGGATATTGCTCGAGCAATATCCGTCTCAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_130386.2-919s21c1
Sequence:CCGGAGCGAATCAAGAACGACTTTCCTCGAGGAAAGTCGTTCTTGATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030781
COLEC12 MISSION shRNA Bacterial Glycerol Stock
collectin sub-family member 12
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000168423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030781.2-318s1c1
Sequence:CCGGGCTAACAATCACAGTAGCCATCTCGAGATGGCTACTGTGATTGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168260    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030781.2-4158s1c1
Sequence:CCGGCCCAAAGACTTGGGAACTAAACTCGAGTTTAGTTCCCAAGTCTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030781.2-1277s1c1
Sequence:CCGGCCACTTGCACAGATACCCTTACTCGAGTAAGGGTATCTGTGCAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030781
COLEC12 MISSION shRNA shRNA Plasmid DNA
collectin sub-family member 12
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000168423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030781.2-318s1c1
Sequence:CCGGGCTAACAATCACAGTAGCCATCTCGAGATGGCTACTGTGATTGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168260    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030781.2-4158s1c1
Sequence:CCGGCCCAAAGACTTGGGAACTAAACTCGAGTTTAGTTCCCAAGTCTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030781.2-1277s1c1
Sequence:CCGGCCACTTGCACAGATACCCTTACTCGAGTAAGGGTATCTGTGCAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030781
COLEC12 MISSION shRNA Lentiviral Transduction Particles
collectin sub-family member 12
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000168423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030781.2-318s1c1
Sequence:CCGGGCTAACAATCACAGTAGCCATCTCGAGATGGCTACTGTGATTGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168260    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030781.2-4158s1c1
Sequence:CCGGCCCAAAGACTTGGGAACTAAACTCGAGTTTAGTTCCCAAGTCTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030781.2-1277s1c1
Sequence:CCGGCCACTTGCACAGATACCCTTACTCGAGTAAGGGTATCTGTGCAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks