EMAIL THIS PAGE TO A FRIEND

COLGALT1

collagen beta(1-O)galactosyltransferase 1

106 Gene Product Result for
Synonyms: GLT25D1
UniProtKB ID: Q8NBJ5, Q8NC64
Gene ID:
Rat(290637) collagen beta(1-O)galactosyltransferase 1
naked mole-rat(101711193) collagen beta(1-O)galactosyltransferase 1
domestic guinea pig(100733295) collagen beta(1-O)galactosyltransferase 1
Zebrafish(567859) glycosyltransferase 25 domain containing 1
Zebrafish(565862) collagen beta(1-O)galactosyltransferase 1
cow(513167) glycosyltransferase 25 domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024656 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024656 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024656 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU119011 MISSION® esiRNA esiRNA human GLT25D1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024656 Rosetta Predictions human pricing
NM_001106067 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024656 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147932 predicted 468
2 SASI_Hs01_00147933 predicted 1293
3 SASI_Hs01_00147934 predicted 1740
4 SASI_Hs01_00147935 predicted 422
5 SASI_Hs01_00147936 predicted 616
6 SASI_Hs01_00147937 predicted 325
7 SASI_Hs01_00147938 predicted 776
8 SASI_Hs02_00357052 predicted 1855
9 SASI_Hs01_00147939 predicted 1624
10 SASI_Hs01_00147940 predicted 459
11 SASI_Hs01_00147941 predicted 843
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106067 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215302 predicted 1276
2 SASI_Rn02_00215303 predicted 250
3 SASI_Rn02_00215304 predicted 1574
4 SASI_Rn02_00215305 predicted 302
5 SASI_Rn02_00215306 predicted 1703
6 SASI_Rn02_00215307 predicted 1706
7 SASI_Rn02_00215308 predicted 1709
8 SASI_Rn02_00215309 predicted 454
9 SASI_Rn02_00215310 predicted 996
10 SASI_Rn02_00215311 predicted 1704
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024656
COLGALT1 MISSION shRNA Bacterial Glycerol Stock
collagen beta(1-O)galactosyltransferase 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024656.2-331s1c1
Sequence:CCGGGCCGTGAAGAGTTTGTACCATCTCGAGATGGTACAAACTCTTCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024656.2-835s1c1
Sequence:CCGGCAGGCAGAGGTTCAGATGTATCTCGAGATACATCTGAACCTCTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024656.2-498s1c1
Sequence:CCGGCCTGTTTGTAGATGCGGACAACTCGAGTTGTCCGCATCTACAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024656.2-1504s1c1
Sequence:CCGGGCCTACGTGATCTCCCTGCAACTCGAGTTGCAGGGAGATCACGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024656.2-1737s1c1
Sequence:CCGGCGTATGGAACAATGAGCACGTCTCGAGACGTGCTCATTGTTCCATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024656.2-331s21c1
Sequence:CCGGGCCGTGAAGAGTTTGTACCATCTCGAGATGGTACAAACTCTTCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024656.2-1737s21c1
Sequence:CCGGCGTATGGAACAATGAGCACGTCTCGAGACGTGCTCATTGTTCCATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024656.2-498s21c1
Sequence:CCGGCCTGTTTGTAGATGCGGACAACTCGAGTTGTCCGCATCTACAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024656.2-1504s21c1
Sequence:CCGGGCCTACGTGATCTCCCTGCAACTCGAGTTGCAGGGAGATCACGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024656
COLGALT1 MISSION shRNA shRNA Plasmid DNA
collagen beta(1-O)galactosyltransferase 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024656.2-331s1c1
Sequence:CCGGGCCGTGAAGAGTTTGTACCATCTCGAGATGGTACAAACTCTTCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024656.2-835s1c1
Sequence:CCGGCAGGCAGAGGTTCAGATGTATCTCGAGATACATCTGAACCTCTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024656.2-498s1c1
Sequence:CCGGCCTGTTTGTAGATGCGGACAACTCGAGTTGTCCGCATCTACAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024656.2-1504s1c1
Sequence:CCGGGCCTACGTGATCTCCCTGCAACTCGAGTTGCAGGGAGATCACGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024656.2-1737s1c1
Sequence:CCGGCGTATGGAACAATGAGCACGTCTCGAGACGTGCTCATTGTTCCATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024656.2-331s21c1
Sequence:CCGGGCCGTGAAGAGTTTGTACCATCTCGAGATGGTACAAACTCTTCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024656.2-1737s21c1
Sequence:CCGGCGTATGGAACAATGAGCACGTCTCGAGACGTGCTCATTGTTCCATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024656.2-498s21c1
Sequence:CCGGCCTGTTTGTAGATGCGGACAACTCGAGTTGTCCGCATCTACAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024656.2-1504s21c1
Sequence:CCGGGCCTACGTGATCTCCCTGCAACTCGAGTTGCAGGGAGATCACGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024656
COLGALT1 MISSION shRNA Lentiviral Transduction Particles
collagen beta(1-O)galactosyltransferase 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024656.2-331s1c1
Sequence:CCGGGCCGTGAAGAGTTTGTACCATCTCGAGATGGTACAAACTCTTCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024656.2-835s1c1
Sequence:CCGGCAGGCAGAGGTTCAGATGTATCTCGAGATACATCTGAACCTCTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024656.2-498s1c1
Sequence:CCGGCCTGTTTGTAGATGCGGACAACTCGAGTTGTCCGCATCTACAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024656.2-1504s1c1
Sequence:CCGGGCCTACGTGATCTCCCTGCAACTCGAGTTGCAGGGAGATCACGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024656.2-1737s1c1
Sequence:CCGGCGTATGGAACAATGAGCACGTCTCGAGACGTGCTCATTGTTCCATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024656.2-331s21c1
Sequence:CCGGGCCGTGAAGAGTTTGTACCATCTCGAGATGGTACAAACTCTTCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024656.2-1737s21c1
Sequence:CCGGCGTATGGAACAATGAGCACGTCTCGAGACGTGCTCATTGTTCCATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024656.2-498s21c1
Sequence:CCGGCCTGTTTGTAGATGCGGACAACTCGAGTTGTCCGCATCTACAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024656.2-1504s21c1
Sequence:CCGGGCCTACGTGATCTCCCTGCAACTCGAGTTGCAGGGAGATCACGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks