EMAIL THIS PAGE TO A FRIEND

COLGALT2

collagen beta(1-O)galactosyltransferase 2

90 Gene Product Result for
Synonyms: C1orf17 GLT25D2
UniProtKB ID: Q8IYK4, O60327, Q9BZR0
Gene ID:
Mouse(269132) collagen beta(1-O)galactosyltransferase 2
Rat(289081) collagen beta(1-O)galactosyltransferase 2
Zebrafish(100003546) collagen beta(1-O)galactosyltransferase 2
domestic guinea pig(100727796) collagen beta(1-O)galactosyltransferase 2
naked mole-rat(101713780) collagen beta(1-O)galactosyltransferase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177756 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177756 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177756 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015101 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015101 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015101 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015101 Rosetta Predictions human pricing
XM_001070927 Rosetta Predictions rat pricing
XM_222718 Rosetta Predictions rat pricing
NM_177756 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015101 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226380 predicted 695
2 SASI_Hs01_00226381 predicted 2231
3 SASI_Hs02_00346987 predicted 636
4 SASI_Hs02_00346988 predicted 1636
5 SASI_Hs01_00226384 predicted 1357
6 SASI_Hs01_00226385 predicted 1933
7 SASI_Hs01_00226386 predicted 2274
8 SASI_Hs01_00226387 predicted 1348
9 SASI_Hs01_00226388 predicted 1566
10 SASI_Hs01_00226389 predicted 1754
11 SASI_Hs01_00226382 predicted 759
12 SASI_Hs01_00226383 predicted 649
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070927 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00333314 predicted 1455
2 SASI_Rn02_00333315 predicted 1625
3 SASI_Rn02_00333316 predicted 1069
4 SASI_Rn02_00333317 predicted 683
5 SASI_Rn02_00333318 predicted 1836
6 SASI_Rn02_00333319 predicted 1213
7 SASI_Rn02_00333320 predicted 1575
8 SASI_Rn02_00333321 predicted 1164
9 SASI_Rn02_00333322 predicted 389
10 SASI_Rn02_00333323 predicted 843
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_222718 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380875 predicted 1453
2 SASI_Rn02_00380876 predicted 1755
3 SASI_Rn02_00380877 predicted 1559
4 SASI_Rn02_00380878 predicted 1761
5 SASI_Rn02_00380879 predicted 473
6 SASI_Rn02_00380880 predicted 1623
7 SASI_Rn02_00380881 predicted 584
8 SASI_Rn02_00380882 predicted 1834
9 SASI_Rn02_00380883 predicted 1479
10 SASI_Rn02_00380884 predicted 1766
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177756 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152154 predicted 2115
2 SASI_Mm01_00152155 predicted 2119
3 SASI_Mm01_00152156 predicted 577
4 SASI_Mm01_00152158 predicted 1986
5 SASI_Mm01_00152159 predicted 544
6 SASI_Mm01_00152160 predicted 1192
7 SASI_Mm01_00152161 predicted 822
8 SASI_Mm02_00348132 predicted 1907
9 SASI_Mm01_00152162 predicted 1600
10 SASI_Mm01_00152163 predicted 1525
11 SASI_Mm01_00152157 predicted 1003
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177756
COLGALT2 MISSION shRNA Bacterial Glycerol Stock
collagen beta(1-O)galactosyltransferase 2
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177756.4-2530s21c1
Sequence:CCGGACTAATCTAAGTGGTCCATTTCTCGAGAAATGGACCACTTAGATTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177756.4-594s21c1
Sequence:CCGGTGCAGCGTTTGTATCACTATGCTCGAGCATAGTGATACAAACGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177756.3-716s1c1
Sequence:CCGGGTCGACAACTTCCTGACTAATCTCGAGATTAGTCAGGAAGTTGTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177756.3-497s1c1
Sequence:CCGGGTGGACAATACAACGGAAATACTCGAGTATTTCCGTTGTATTGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217789    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177756.3-813s1c1
Sequence:CCGGCTAACTTCTGGTGCGGAATTACTCGAGTAATTCCGCACCAGAAGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177756.3-584s1c1
Sequence:CCGGCCAGAGTCTTACCCTGATGAACTCGAGTTCATCAGGGTAAGACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182429    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177756.3-3227s1c1
Sequence:CCGGGCGCATCTGAATTGCCTGAATCTCGAGATTCAGGCAATTCAGATGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177756.3-595s1c1
Sequence:CCGGCCCTGATGAAATCGGACCAAACTCGAGTTTGGTCCGATTTCATCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177756.3-1655s1c1
Sequence:CCGGGCAGTGCCCAATGTTGTAAATCTCGAGATTTACAACATTGGGCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181826    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177756.3-3736s1c1
Sequence:CCGGGCCTGGCTTTAACTGTGTATTCTCGAGAATACACAGTTAAAGCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177756.3-1820s1c1
Sequence:CCGGGCTGAGTACAAGGAGTATTATCTCGAGATAATACTCCTTGTACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177756.3-1060s1c1
Sequence:CCGGCCTGTGCAACAAGGAACACTACTCGAGTAGTGTTCCTTGTTGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177756.3-1670s1c1
Sequence:CCGGGTAAATCTCGTCGAAGCTGATCTCGAGATCAGCTTCGACGAGATTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177756
COLGALT2 MISSION shRNA shRNA Plasmid DNA
collagen beta(1-O)galactosyltransferase 2
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177756.4-2530s21c1
Sequence:CCGGACTAATCTAAGTGGTCCATTTCTCGAGAAATGGACCACTTAGATTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177756.4-594s21c1
Sequence:CCGGTGCAGCGTTTGTATCACTATGCTCGAGCATAGTGATACAAACGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177756.3-716s1c1
Sequence:CCGGGTCGACAACTTCCTGACTAATCTCGAGATTAGTCAGGAAGTTGTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177756.3-497s1c1
Sequence:CCGGGTGGACAATACAACGGAAATACTCGAGTATTTCCGTTGTATTGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217789    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177756.3-813s1c1
Sequence:CCGGCTAACTTCTGGTGCGGAATTACTCGAGTAATTCCGCACCAGAAGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177756.3-584s1c1
Sequence:CCGGCCAGAGTCTTACCCTGATGAACTCGAGTTCATCAGGGTAAGACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182429    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177756.3-3227s1c1
Sequence:CCGGGCGCATCTGAATTGCCTGAATCTCGAGATTCAGGCAATTCAGATGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177756.3-595s1c1
Sequence:CCGGCCCTGATGAAATCGGACCAAACTCGAGTTTGGTCCGATTTCATCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177756.3-1655s1c1
Sequence:CCGGGCAGTGCCCAATGTTGTAAATCTCGAGATTTACAACATTGGGCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181826    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177756.3-3736s1c1
Sequence:CCGGGCCTGGCTTTAACTGTGTATTCTCGAGAATACACAGTTAAAGCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177756.3-1820s1c1
Sequence:CCGGGCTGAGTACAAGGAGTATTATCTCGAGATAATACTCCTTGTACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177756.3-1060s1c1
Sequence:CCGGCCTGTGCAACAAGGAACACTACTCGAGTAGTGTTCCTTGTTGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177756.3-1670s1c1
Sequence:CCGGGTAAATCTCGTCGAAGCTGATCTCGAGATCAGCTTCGACGAGATTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177756
COLGALT2 MISSION shRNA Lentiviral Transduction Particles
collagen beta(1-O)galactosyltransferase 2
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177756.4-2530s21c1
Sequence:CCGGACTAATCTAAGTGGTCCATTTCTCGAGAAATGGACCACTTAGATTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177756.4-594s21c1
Sequence:CCGGTGCAGCGTTTGTATCACTATGCTCGAGCATAGTGATACAAACGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177756.3-716s1c1
Sequence:CCGGGTCGACAACTTCCTGACTAATCTCGAGATTAGTCAGGAAGTTGTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177756.3-497s1c1
Sequence:CCGGGTGGACAATACAACGGAAATACTCGAGTATTTCCGTTGTATTGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217789    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177756.3-813s1c1
Sequence:CCGGCTAACTTCTGGTGCGGAATTACTCGAGTAATTCCGCACCAGAAGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177756.3-584s1c1
Sequence:CCGGCCAGAGTCTTACCCTGATGAACTCGAGTTCATCAGGGTAAGACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182429    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177756.3-3227s1c1
Sequence:CCGGGCGCATCTGAATTGCCTGAATCTCGAGATTCAGGCAATTCAGATGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177756.3-595s1c1
Sequence:CCGGCCCTGATGAAATCGGACCAAACTCGAGTTTGGTCCGATTTCATCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177756.3-1655s1c1
Sequence:CCGGGCAGTGCCCAATGTTGTAAATCTCGAGATTTACAACATTGGGCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181826    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177756.3-3736s1c1
Sequence:CCGGGCCTGGCTTTAACTGTGTATTCTCGAGAATACACAGTTAAAGCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177756.3-1820s1c1
Sequence:CCGGGCTGAGTACAAGGAGTATTATCTCGAGATAATACTCCTTGTACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177756.3-1060s1c1
Sequence:CCGGCCTGTGCAACAAGGAACACTACTCGAGTAGTGTTCCTTGTTGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177756.3-1670s1c1
Sequence:CCGGGTAAATCTCGTCGAAGCTGATCTCGAGATCAGCTTCGACGAGATTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015101
VALIDATED
COLGALT2 MISSION shRNA Bacterial Glycerol Stock
collagen beta(1-O)galactosyltransferase 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000278938    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015101.2-2383s21c1
Sequence:CCGGCTAGTGTGATAGATCGAAATTCTCGAGAATTTCGATCTATCACACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015101.2-1023s21c1
Sequence:CCGGCTACGTTCAGATTCGAGAATGCTCGAGCATTCTCGAATCTGAACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015101.2-1779s21c1
Sequence:CCGGTAGGAAGAGGATGCAAGTAAACTCGAGTTTACTTGCATCCTCTTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015101.2-1627s21c1
Sequence:CCGGTCAGTCTGGAAAGAGGTAATTCTCGAGAATTACCTCTTTCCAGACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015101.2-1411s21c1
Sequence:CCGGATAAACCTCAAACGCAGAAAGCTCGAGCTTTCTGCGTTTGAGGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034739    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015101.1-2655s1c1
Sequence:CCGGCCACACTTATTGGTCTAGTTTCTCGAGAAACTAGACCAATAAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015101.1-753s1c1
Sequence:CCGGCCCTGATGAAATTGGACCAAACTCGAGTTTGGTCCAATTTCATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015101.1-640s1c1
Sequence:CCGGGCCACTGATCACAATGTGGATCTCGAGATCCACATTGTGATCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015101.1-1656s1c1
Sequence:CCGGGCTAGAGAAGACTCTTGTAATCTCGAGATTACAAGAGTCTTCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015101.1-1978s1c1
Sequence:CCGGGCCGAGTACAAGGAGTATTATCTCGAGATAATACTCCTTGTACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015101
VALIDATED
COLGALT2 MISSION shRNA shRNA Plasmid DNA
collagen beta(1-O)galactosyltransferase 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000278938    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015101.2-2383s21c1
Sequence:CCGGCTAGTGTGATAGATCGAAATTCTCGAGAATTTCGATCTATCACACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015101.2-1023s21c1
Sequence:CCGGCTACGTTCAGATTCGAGAATGCTCGAGCATTCTCGAATCTGAACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015101.2-1779s21c1
Sequence:CCGGTAGGAAGAGGATGCAAGTAAACTCGAGTTTACTTGCATCCTCTTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015101.2-1627s21c1
Sequence:CCGGTCAGTCTGGAAAGAGGTAATTCTCGAGAATTACCTCTTTCCAGACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015101.2-1411s21c1
Sequence:CCGGATAAACCTCAAACGCAGAAAGCTCGAGCTTTCTGCGTTTGAGGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034739    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015101.1-2655s1c1
Sequence:CCGGCCACACTTATTGGTCTAGTTTCTCGAGAAACTAGACCAATAAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015101.1-753s1c1
Sequence:CCGGCCCTGATGAAATTGGACCAAACTCGAGTTTGGTCCAATTTCATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015101.1-640s1c1
Sequence:CCGGGCCACTGATCACAATGTGGATCTCGAGATCCACATTGTGATCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015101.1-1656s1c1
Sequence:CCGGGCTAGAGAAGACTCTTGTAATCTCGAGATTACAAGAGTCTTCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015101.1-1978s1c1
Sequence:CCGGGCCGAGTACAAGGAGTATTATCTCGAGATAATACTCCTTGTACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015101
VALIDATED
COLGALT2 MISSION shRNA Lentiviral Transduction Particles
collagen beta(1-O)galactosyltransferase 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000278938    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015101.2-2383s21c1
Sequence:CCGGCTAGTGTGATAGATCGAAATTCTCGAGAATTTCGATCTATCACACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015101.2-1023s21c1
Sequence:CCGGCTACGTTCAGATTCGAGAATGCTCGAGCATTCTCGAATCTGAACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015101.2-1779s21c1
Sequence:CCGGTAGGAAGAGGATGCAAGTAAACTCGAGTTTACTTGCATCCTCTTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015101.2-1627s21c1
Sequence:CCGGTCAGTCTGGAAAGAGGTAATTCTCGAGAATTACCTCTTTCCAGACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015101.2-1411s21c1
Sequence:CCGGATAAACCTCAAACGCAGAAAGCTCGAGCTTTCTGCGTTTGAGGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034739    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015101.1-2655s1c1
Sequence:CCGGCCACACTTATTGGTCTAGTTTCTCGAGAAACTAGACCAATAAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015101.1-753s1c1
Sequence:CCGGCCCTGATGAAATTGGACCAAACTCGAGTTTGGTCCAATTTCATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015101.1-640s1c1
Sequence:CCGGGCCACTGATCACAATGTGGATCTCGAGATCCACATTGTGATCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015101.1-1656s1c1
Sequence:CCGGGCTAGAGAAGACTCTTGTAATCTCGAGATTACAAGAGTCTTCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015101.1-1978s1c1
Sequence:CCGGGCCGAGTACAAGGAGTATTATCTCGAGATAATACTCCTTGTACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks