EMAIL THIS PAGE TO A FRIEND

COLQ

collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase

Synonyms: EAD
Gene ID:
Human(8292) Summary: This gene encodes the subunit of a collagen-like molecule associated with acetylcholinesterase in skeletal muscle. Each molecule is composed of three identical subunits. Each subunit contains a proline-rich attachment domain (PRAD) that binds an acetylcholinesterase tetramer to anchor the catalytic subunit of the enzyme to the basal lamina. Mutations in this gene are associated with endplate acetylcholinesterase deficiency. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(382864) collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase
Rat(29755) collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase
chicken(776178) collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase
domestic cat(101093134) collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase
cow(514615) collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase
Horse(100052475) collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase
dog(608697) collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase
sheep(101112947) collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase
naked mole-rat(101705365) collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase
domestic guinea pig(100732075) collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase
169 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005677 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005677 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005677 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009937 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009937 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009937 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005677 Rosetta Predictions human pricing
NM_080538 Rosetta Predictions human pricing
NM_080539 Rosetta Predictions human pricing
NM_080540 Rosetta Predictions human pricing
NM_080541 Rosetta Predictions human pricing
NM_080542 Rosetta Predictions human pricing
NM_080543 Rosetta Predictions human pricing
NM_080544 Rosetta Predictions human pricing
NM_019274 Rosetta Predictions rat pricing
NM_009937 Rosetta Predictions mouse pricing
XM_356716 Rosetta Predictions mouse pricing
XM_898771 Rosetta Predictions mouse pricing
XM_898787 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005677 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214241 predicted 1666
2 SASI_Hs02_00340066 predicted 1641
3 SASI_Hs01_00214243 predicted 1746
4 SASI_Hs01_00214244 predicted 1621
5 SASI_Hs01_00214246 predicted 1674
6 SASI_Hs02_00340067 predicted 1832
7 SASI_Hs01_00214247 predicted 995
8 SASI_Hs01_00214248 predicted 1198
9 SASI_Hs01_00214250 predicted 1604
10 SASI_Hs02_00340068 predicted 1408
11 SASI_Hs01_00214242 predicted 1841
12 SASI_Hs01_00214245 predicted 1818
13 SASI_Hs01_00214249 predicted 140
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080538 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150915 predicted 1794
2 SASI_Hs02_00362279 predicted 1772
3 SASI_Hs01_00150917 predicted 1871
4 SASI_Hs01_00150918 predicted 1749
5 SASI_Hs01_00150920 predicted 1801
6 SASI_Hs02_00362280 predicted 1957
7 SASI_Hs01_00150921 predicted 1118
8 SASI_Hs01_00150922 predicted 1336
9 SASI_Hs01_00150923 predicted 1730
10 SASI_Hs02_00362281 predicted 1531
11 SASI_Hs01_00150916 predicted 1691
12 SASI_Hs01_00150919 predicted 1674
13 SASI_Hs01_00150924 predicted 1007
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080539 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207693 predicted 1558
2 SASI_Hs02_00362282 predicted 1538
3 SASI_Hs01_00207695 predicted 1647
4 SASI_Hs01_00207696 predicted 1521
5 SASI_Hs01_00207698 predicted 1569
6 SASI_Hs02_00362283 predicted 1729
7 SASI_Hs01_00207702 predicted 1505
8 SASI_Hs02_00362284 predicted 1306
9 SASI_Hs02_00362285 predicted 1654
10 SASI_Hs02_00362286 predicted 135
11 SASI_Hs01_00207694 predicted 1733
12 SASI_Hs01_00207697 predicted 1719
13 SASI_Hs01_00207699 predicted 894
14 SASI_Hs01_00207700 predicted 1103
15 SASI_Hs01_00207701 predicted 145
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080540 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212031 predicted 1661
2 SASI_Hs01_00212032 predicted 1819
3 SASI_Hs01_00212033 predicted 1734
4 SASI_Hs01_00212034 predicted 1616
5 SASI_Hs01_00212035 predicted 1807
6 SASI_Hs01_00212036 predicted 1664
7 SASI_Hs01_00212037 predicted 980
8 SASI_Hs01_00212038 predicted 1192
9 SASI_Hs01_00212039 predicted 1595
10 SASI_Hs01_00212040 predicted 1141
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080541 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200206 predicted 1642
2 SASI_Hs02_00362287 predicted 1610
3 SASI_Hs01_00200208 predicted 1724
4 SASI_Hs01_00200209 predicted 1595
5 SASI_Hs01_00200211 predicted 1647
6 SASI_Hs02_00362288 predicted 1805
7 SASI_Hs01_00200212 predicted 964
8 SASI_Hs01_00200213 predicted 1179
9 SASI_Hs01_00200215 predicted 1574
10 SASI_Hs02_00362289 predicted 1378
11 SASI_Hs01_00200207 predicted 1813
12 SASI_Hs01_00200210 predicted 1789
13 SASI_Hs01_00200214 predicted 141
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080542 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069592 predicted 1016
2 SASI_Hs01_00069593 predicted 796
3 SASI_Hs01_00069594 predicted 152
4 SASI_Hs01_00069595 predicted 1172
5 SASI_Hs01_00069596 predicted 1125
6 SASI_Hs01_00069597 predicted 841
7 SASI_Hs01_00069598 predicted 186
8 SASI_Hs01_00069599 predicted 1341
9 SASI_Hs01_00069600 predicted 193
10 SASI_Hs01_00069601 predicted 618
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080543 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231201 predicted 144
2 SASI_Hs01_00231202 predicted 1465
3 SASI_Hs01_00231203 predicted 1398
4 SASI_Hs01_00231204 predicted 1440
5 SASI_Hs01_00231205 predicted 1012
6 SASI_Hs01_00231206 predicted 189
7 SASI_Hs01_00231207 predicted 1187
8 SASI_Hs01_00231208 predicted 203
9 SASI_Hs01_00231209 predicted 616
10 SASI_Hs01_00231210 predicted 644
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080544 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234896 predicted 1179
2 SASI_Hs01_00234897 predicted 1160
3 SASI_Hs01_00234899 predicted 1277
4 SASI_Hs01_00234900 predicted 1262
5 SASI_Hs01_00234901 predicted 1136
6 SASI_Hs01_00234903 predicted 1184
7 SASI_Hs01_00234904 predicted 1251
8 SASI_Hs01_00234905 predicted 1144
9 SASI_Hs02_00362290 predicted 1315
10 SASI_Hs01_00234902 predicted 1331
11 SASI_Hs01_00234898 predicted 1354
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019274 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103830 predicted 1359
2 SASI_Rn01_00103831 predicted 1332
3 SASI_Rn01_00103832 predicted 1145
4 SASI_Rn01_00103833 predicted 1688
5 SASI_Rn02_00262189 predicted 1690
6 SASI_Rn01_00103834 predicted 1599
7 SASI_Rn01_00103837 predicted 1675
8 SASI_Rn02_00262190 predicted 1330
9 SASI_Rn01_00103839 predicted 1200
10 SASI_Rn02_00262191 predicted 1680
11 SASI_Rn01_00103835 predicted 1219
12 SASI_Rn01_00103836 predicted 221
13 SASI_Rn01_00103838 predicted 668
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009937 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317483 predicted 1785
2 SASI_Mm02_00317484 predicted 1138
3 SASI_Mm02_00317485 predicted 1657
4 SASI_Mm02_00317486 predicted 1690
5 SASI_Mm02_00317487 predicted 1220
6 SASI_Mm02_00317488 predicted 1778
7 SASI_Mm02_00317489 predicted 1600
8 SASI_Mm02_00317490 predicted 1420
9 SASI_Mm02_00317491 predicted 1761
10 SASI_Mm02_00317492 predicted 1297
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_356716 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00254564 predicted 1135
2 SASI_Mm01_00254565 predicted 1220
3 SASI_Mm01_00254566 predicted 1142
4 SASI_Mm01_00254567 predicted 1161
5 SASI_Mm01_00254568 predicted 1163
6 SASI_Mm01_00254569 predicted 767
7 SASI_Mm01_00254570 predicted 1287
8 SASI_Mm01_00254571 predicted 1154
9 SASI_Mm01_00254572 predicted 869
10 SASI_Mm01_00254573 predicted 887
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898771 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00241279 predicted 1075
2 SASI_Mm01_00241280 predicted 1157
3 SASI_Mm01_00241281 predicted 1071
4 SASI_Mm01_00241282 predicted 1098
5 SASI_Mm01_00241283 predicted 1104
6 SASI_Mm01_00241284 predicted 874
7 SASI_Mm01_00241285 predicted 1220
8 SASI_Mm01_00241286 predicted 1087
9 SASI_Mm01_00241287 predicted 1077
10 SASI_Mm01_00241288 predicted 815
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898787 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00217736 predicted 897
2 SASI_Mm01_00217737 predicted 983
3 SASI_Mm01_00217738 predicted 909
4 SASI_Mm01_00217739 predicted 930
5 SASI_Mm01_00217740 predicted 936
6 SASI_Mm01_00217741 predicted 521
7 SASI_Mm01_00217742 predicted 1055
8 SASI_Mm01_00217743 predicted 917
9 SASI_Mm01_00217744 predicted 630
10 SASI_Mm01_00217745 predicted 656
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005677
COLQ MISSION shRNA Bacterial Glycerol Stock
collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005677.2-759s1c1
Sequence:CCGGGAAAGGTGAAATGGGTCCAAACTCGAGTTTGGACCCATTTCACCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005677.2-196s1c1
Sequence:CCGGCCGACTTTCATCAACAGCGTTCTCGAGAACGCTGTTGATGAAAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005677.2-354s1c1
Sequence:CCGGCCCAGACATGAAGAATCTCATCTCGAGATGAGATTCTTCATGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005677.2-1206s1c1
Sequence:CCGGCCCTTTCTACCCTGTGGATTACTCGAGTAATCCACAGGGTAGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005677.2-732s1c1
Sequence:CCGGCCCAGGATTTCCTGGAATGTTCTCGAGAACATTCCAGGAAATCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437425    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005677.3-1752s21c1
Sequence:CCGGGCCAAACAACCGGCTACAATGCTCGAGCATTGTAGCCGGTTGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005677.3-1009s21c1
Sequence:CCGGCCCACTATGAATGTGAATAACCTCGAGGTTATTCACATTCATAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005677.3-1411s21c1
Sequence:CCGGACCTATCTCCCTGGGTCATATCTCGAGATATGACCCAGGGAGATAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005677
COLQ MISSION shRNA shRNA Plasmid DNA
collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005677.2-759s1c1
Sequence:CCGGGAAAGGTGAAATGGGTCCAAACTCGAGTTTGGACCCATTTCACCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005677.2-196s1c1
Sequence:CCGGCCGACTTTCATCAACAGCGTTCTCGAGAACGCTGTTGATGAAAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005677.2-354s1c1
Sequence:CCGGCCCAGACATGAAGAATCTCATCTCGAGATGAGATTCTTCATGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005677.2-1206s1c1
Sequence:CCGGCCCTTTCTACCCTGTGGATTACTCGAGTAATCCACAGGGTAGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005677.2-732s1c1
Sequence:CCGGCCCAGGATTTCCTGGAATGTTCTCGAGAACATTCCAGGAAATCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437425    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005677.3-1752s21c1
Sequence:CCGGGCCAAACAACCGGCTACAATGCTCGAGCATTGTAGCCGGTTGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005677.3-1009s21c1
Sequence:CCGGCCCACTATGAATGTGAATAACCTCGAGGTTATTCACATTCATAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005677.3-1411s21c1
Sequence:CCGGACCTATCTCCCTGGGTCATATCTCGAGATATGACCCAGGGAGATAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005677
COLQ MISSION shRNA Lentiviral Transduction Particles
collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005677.2-759s1c1
Sequence:CCGGGAAAGGTGAAATGGGTCCAAACTCGAGTTTGGACCCATTTCACCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005677.2-196s1c1
Sequence:CCGGCCGACTTTCATCAACAGCGTTCTCGAGAACGCTGTTGATGAAAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005677.2-354s1c1
Sequence:CCGGCCCAGACATGAAGAATCTCATCTCGAGATGAGATTCTTCATGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005677.2-1206s1c1
Sequence:CCGGCCCTTTCTACCCTGTGGATTACTCGAGTAATCCACAGGGTAGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005677.2-732s1c1
Sequence:CCGGCCCAGGATTTCCTGGAATGTTCTCGAGAACATTCCAGGAAATCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437425    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005677.3-1752s21c1
Sequence:CCGGGCCAAACAACCGGCTACAATGCTCGAGCATTGTAGCCGGTTGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005677.3-1009s21c1
Sequence:CCGGCCCACTATGAATGTGAATAACCTCGAGGTTATTCACATTCATAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005677.3-1411s21c1
Sequence:CCGGACCTATCTCCCTGGGTCATATCTCGAGATATGACCCAGGGAGATAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009937
COLQ MISSION shRNA Bacterial Glycerol Stock
collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009937.2-1324s21c1
Sequence:CCGGGATGGCTGCATCGACTGTCATCTCGAGATGACAGTCGATGCAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009937.2-1426s21c1
Sequence:CCGGACCTATCTCCCTGGATCATACCTCGAGGTATGATCCAGGGAGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009937.2-1349s21c1
Sequence:CCGGCCTACTGTGGAGACGGTTACCCTCGAGGGTAACCGTCTCCACAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009937.2-1388s21c1
Sequence:CCGGACTGTGACGGCTCTGACTTTGCTCGAGCAAAGTCAGAGCCGTCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009937.2-2058s21c1
Sequence:CCGGTGGCCAGAGCCTGGATCAATTCTCGAGAATTGATCCAGGCTCTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009937
COLQ MISSION shRNA shRNA Plasmid DNA
collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009937.2-1324s21c1
Sequence:CCGGGATGGCTGCATCGACTGTCATCTCGAGATGACAGTCGATGCAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009937.2-1426s21c1
Sequence:CCGGACCTATCTCCCTGGATCATACCTCGAGGTATGATCCAGGGAGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009937.2-1349s21c1
Sequence:CCGGCCTACTGTGGAGACGGTTACCCTCGAGGGTAACCGTCTCCACAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009937.2-1388s21c1
Sequence:CCGGACTGTGACGGCTCTGACTTTGCTCGAGCAAAGTCAGAGCCGTCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009937.2-2058s21c1
Sequence:CCGGTGGCCAGAGCCTGGATCAATTCTCGAGAATTGATCCAGGCTCTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009937
COLQ MISSION shRNA Lentiviral Transduction Particles
collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009937.2-1324s21c1
Sequence:CCGGGATGGCTGCATCGACTGTCATCTCGAGATGACAGTCGATGCAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009937.2-1426s21c1
Sequence:CCGGACCTATCTCCCTGGATCATACCTCGAGGTATGATCCAGGGAGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009937.2-1349s21c1
Sequence:CCGGCCTACTGTGGAGACGGTTACCCTCGAGGGTAACCGTCTCCACAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009937.2-1388s21c1
Sequence:CCGGACTGTGACGGCTCTGACTTTGCTCGAGCAAAGTCAGAGCCGTCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009937.2-2058s21c1
Sequence:CCGGTGGCCAGAGCCTGGATCAATTCTCGAGAATTGATCCAGGCTCTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks