EMAIL THIS PAGE TO A FRIEND

COMMD10

COMM domain containing 10

82 Gene Product Result for
Synonyms: PTD002
UniProtKB ID: Q9Y6G5, D3DT07, Q9P077
Gene ID:
Mouse(69456) COMM domain containing 10
Rat(361323) COMM domain containing 10
sheep(101116310) COMM domain containing 10
domestic guinea pig(100714132) COMM domain containing 10
naked mole-rat(101718834) COMM domain containing 10
chicken(427388) COMM domain containing 10
cow(538706) COMM domain containing 10
domestic cat(101091079) COMM domain containing 10
dog(474635) COMM domain containing 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178377 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178377 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178377 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016144 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016144 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016144 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016144 Rosetta Predictions human pricing
NM_001004276 Rosetta Predictions rat pricing
NM_178377 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016144 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122518 predicted 350
2 SASI_Hs01_00122519 predicted 772
3 SASI_Hs02_00348939 predicted 354
4 SASI_Hs01_00122521 predicted 291
5 SASI_Hs01_00122522 predicted 835
6 SASI_Hs01_00122523 predicted 807
7 SASI_Hs01_00122524 predicted 798
8 SASI_Hs01_00122525 predicted 304
9 SASI_Hs01_00122526 predicted 341
10 SASI_Hs01_00122527 predicted 559
11 SASI_Hs01_00122520 predicted 543
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004276 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083822 predicted 536
2 SASI_Rn01_00083823 predicted 744
3 SASI_Rn01_00083824 predicted 614
4 SASI_Rn02_00198313 predicted 670
5 SASI_Rn01_00083825 predicted 360
6 SASI_Rn01_00083826 predicted 262
7 SASI_Rn01_00083827 predicted 875
8 SASI_Rn02_00198314 predicted 722
9 SASI_Rn01_00083829 predicted 614
10 SASI_Rn01_00083830 predicted 584
11 SASI_Rn01_00083828 predicted 867
12 SASI_Rn01_00083831 predicted 244
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178377 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183430 predicted 275
2 SASI_Mm01_00183431 predicted 609
3 SASI_Mm01_00183432 predicted 255
4 SASI_Mm01_00183433 predicted 552
5 SASI_Mm01_00183436 predicted 658
6 SASI_Mm01_00183438 predicted 514
7 SASI_Mm01_00183439 predicted 412
8 SASI_Mm02_00348774 predicted 485
9 SASI_Mm02_00348775 predicted 357
10 SASI_Mm01_00183434 predicted 210
11 SASI_Mm01_00183435 predicted 1112
12 SASI_Mm01_00183437 predicted 420
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178377
VALIDATED
COMMD10 MISSION shRNA Bacterial Glycerol Stock
COMM domain containing 10
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178377.3-226s1c1
Sequence:CCGGCTGGAGACAATATCATTTGTTCTCGAGAACAAATGATATTGTCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178377.3-561s1c1
Sequence:CCGGGCTGTTCGATTTCTACAACAACTCGAGTTGTTGTAGAAATCGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178377.3-190s1c1
Sequence:CCGGGCATTCTCTCTAGAGAAACAACTCGAGTTGTTTCTCTAGAGAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178377.3-313s1c1
Sequence:CCGGCTTAGGAAAGACAAAGCGGAACTCGAGTTCCGCTTTGTCTTTCCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178377.3-71s1c1
Sequence:CCGGCGCTGATAAATGCAATAGACACTCGAGTGTCTATTGCATTTATCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178377
VALIDATED
COMMD10 MISSION shRNA shRNA Plasmid DNA
COMM domain containing 10
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178377.3-226s1c1
Sequence:CCGGCTGGAGACAATATCATTTGTTCTCGAGAACAAATGATATTGTCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178377.3-561s1c1
Sequence:CCGGGCTGTTCGATTTCTACAACAACTCGAGTTGTTGTAGAAATCGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178377.3-190s1c1
Sequence:CCGGGCATTCTCTCTAGAGAAACAACTCGAGTTGTTTCTCTAGAGAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178377.3-313s1c1
Sequence:CCGGCTTAGGAAAGACAAAGCGGAACTCGAGTTCCGCTTTGTCTTTCCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178377.3-71s1c1
Sequence:CCGGCGCTGATAAATGCAATAGACACTCGAGTGTCTATTGCATTTATCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178377
VALIDATED
COMMD10 MISSION shRNA Lentiviral Transduction Particles
COMM domain containing 10
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178377.3-226s1c1
Sequence:CCGGCTGGAGACAATATCATTTGTTCTCGAGAACAAATGATATTGTCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178377.3-561s1c1
Sequence:CCGGGCTGTTCGATTTCTACAACAACTCGAGTTGTTGTAGAAATCGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178377.3-190s1c1
Sequence:CCGGGCATTCTCTCTAGAGAAACAACTCGAGTTGTTTCTCTAGAGAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178377.3-313s1c1
Sequence:CCGGCTTAGGAAAGACAAAGCGGAACTCGAGTTCCGCTTTGTCTTTCCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178377.3-71s1c1
Sequence:CCGGCGCTGATAAATGCAATAGACACTCGAGTGTCTATTGCATTTATCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016144
VALIDATED
COMMD10 MISSION shRNA Bacterial Glycerol Stock
COMM domain containing 10
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016144.2-299s1c1
Sequence:CCGGGCAGCAGCAATTAGAGAACATCTCGAGATGTTCTCTAATTGCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016144.2-75s1c1
Sequence:CCGGGCAGTGTCACTGATAAATGCACTCGAGTGCATTTATCAGTGACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166847    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016144.2-300s1c1
Sequence:CCGGCAGCAGCAATTAGAGAACATTCTCGAGAATGTTCTCTAATTGCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016144.2-228s1c1
Sequence:CCGGCACCTAGTTCTTGAAACAATACTCGAGTATTGTTTCAAGAACTAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167843    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016144.2-752s1c1
Sequence:CCGGGCTTATCACTTCTTAGACAAACTCGAGTTTGTCTAAGAAGTGATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016144.2-159s1c1
Sequence:CCGGGAGAGCAGTTTCAGTGAAGAACTCGAGTTCTTCACTGAAACTGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_016144.2-299s21c1
Sequence:CCGGGCAGCAGCAATTAGAGAACATCTCGAGATGTTCTCTAATTGCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016144.2-159s21c1
Sequence:CCGGGAGAGCAGTTTCAGTGAAGAACTCGAGTTCTTCACTGAAACTGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280884    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_016144.2-752s21c1
Sequence:CCGGGCTTATCACTTCTTAGACAAACTCGAGTTTGTCTAAGAAGTGATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_016144.2-75s21c1
Sequence:CCGGGCAGTGTCACTGATAAATGCACTCGAGTGCATTTATCAGTGACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016144
VALIDATED
COMMD10 MISSION shRNA shRNA Plasmid DNA
COMM domain containing 10
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016144.2-299s1c1
Sequence:CCGGGCAGCAGCAATTAGAGAACATCTCGAGATGTTCTCTAATTGCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016144.2-75s1c1
Sequence:CCGGGCAGTGTCACTGATAAATGCACTCGAGTGCATTTATCAGTGACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166847    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016144.2-300s1c1
Sequence:CCGGCAGCAGCAATTAGAGAACATTCTCGAGAATGTTCTCTAATTGCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016144.2-228s1c1
Sequence:CCGGCACCTAGTTCTTGAAACAATACTCGAGTATTGTTTCAAGAACTAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167843    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016144.2-752s1c1
Sequence:CCGGGCTTATCACTTCTTAGACAAACTCGAGTTTGTCTAAGAAGTGATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016144.2-159s1c1
Sequence:CCGGGAGAGCAGTTTCAGTGAAGAACTCGAGTTCTTCACTGAAACTGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_016144.2-299s21c1
Sequence:CCGGGCAGCAGCAATTAGAGAACATCTCGAGATGTTCTCTAATTGCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016144.2-159s21c1
Sequence:CCGGGAGAGCAGTTTCAGTGAAGAACTCGAGTTCTTCACTGAAACTGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280884    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_016144.2-752s21c1
Sequence:CCGGGCTTATCACTTCTTAGACAAACTCGAGTTTGTCTAAGAAGTGATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_016144.2-75s21c1
Sequence:CCGGGCAGTGTCACTGATAAATGCACTCGAGTGCATTTATCAGTGACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016144
VALIDATED
COMMD10 MISSION shRNA Lentiviral Transduction Particles
COMM domain containing 10
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016144.2-299s1c1
Sequence:CCGGGCAGCAGCAATTAGAGAACATCTCGAGATGTTCTCTAATTGCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016144.2-75s1c1
Sequence:CCGGGCAGTGTCACTGATAAATGCACTCGAGTGCATTTATCAGTGACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166847    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016144.2-300s1c1
Sequence:CCGGCAGCAGCAATTAGAGAACATTCTCGAGAATGTTCTCTAATTGCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016144.2-228s1c1
Sequence:CCGGCACCTAGTTCTTGAAACAATACTCGAGTATTGTTTCAAGAACTAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167843    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016144.2-752s1c1
Sequence:CCGGGCTTATCACTTCTTAGACAAACTCGAGTTTGTCTAAGAAGTGATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016144.2-159s1c1
Sequence:CCGGGAGAGCAGTTTCAGTGAAGAACTCGAGTTCTTCACTGAAACTGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_016144.2-299s21c1
Sequence:CCGGGCAGCAGCAATTAGAGAACATCTCGAGATGTTCTCTAATTGCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016144.2-159s21c1
Sequence:CCGGGAGAGCAGTTTCAGTGAAGAACTCGAGTTCTTCACTGAAACTGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280884    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_016144.2-752s21c1
Sequence:CCGGGCTTATCACTTCTTAGACAAACTCGAGTTTGTCTAAGAAGTGATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_016144.2-75s21c1
Sequence:CCGGGCAGTGTCACTGATAAATGCACTCGAGTGCATTTATCAGTGACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks