EMAIL THIS PAGE TO A FRIEND

COMMD1

copper metabolism (Murr1) domain containing 1

54 Gene Product Result for
Synonyms: C2orf5 MURR1
UniProtKB ID: Q8N668, Q96GS0
Gene ID:
Human(150684) Summary: COMMD1 is a regulator of copper homeostasis, sodium uptake, and NF-kappa-B (see MIM 164011) signaling (de Bie et al., 2005 [PubMed 16267171]
Mouse(17846) COMM domain containing 1
Rat(289831) copper metabolism (Murr1) domain containing 1
Zebrafish(692293) copper metabolism (Murr1) domain containing 1
domestic cat(101101457) copper metabolism (Murr1) domain containing 1
cow(534683) copper metabolism (Murr1) domain containing 1
chicken(769006) copper metabolism (Murr1) domain containing 1
dog(403590) copper metabolism (Murr1) domain containing 1
domestic guinea pig(100731728) copper metabolism (Murr1) domain containing 1
sheep(101117656) copper metabolism (Murr1) domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152516 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152516 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152516 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144514 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144514 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144514 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152516 Rosetta Predictions human pricing
NM_001115022 Rosetta Predictions rat pricing
NM_144514 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152516 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168282 predicted 425
2 SASI_Hs01_00168283 predicted 428
3 SASI_Hs01_00168284 predicted 447
4 SASI_Hs01_00168285 predicted 376
5 SASI_Hs02_00366302 predicted 225
6 SASI_Hs01_00168286 predicted 472
7 SASI_Hs02_00366303 predicted 410
8 SASI_Hs01_00168287 predicted 459
9 SASI_Hs01_00168289 predicted 229
10 SASI_Hs01_00168290 predicted 450
11 SASI_Hs01_00168288 predicted 331
12 SASI_Hs01_00168291 predicted 431
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001115022 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252393 predicted 600
2 SASI_Rn02_00252394 predicted 264
3 SASI_Rn02_00252395 predicted 464
4 SASI_Rn02_00252396 predicted 338
5 SASI_Rn02_00252397 predicted 566
6 SASI_Rn02_00252398 predicted 365
7 SASI_Rn02_00252399 predicted 418
8 SASI_Rn02_00252400 predicted 517
9 SASI_Rn02_00252401 predicted 573
10 SASI_Rn02_00252402 predicted 224
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144514 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00125284 predicted 243
2 SASI_Mm01_00125285 predicted 394
3 SASI_Mm01_00125286 predicted 569
4 SASI_Mm01_00125287 predicted 242
5 SASI_Mm01_00125288 predicted 500
6 SASI_Mm02_00340030 predicted 240
7 SASI_Mm01_00125289 predicted 219
8 SASI_Mm01_00125290 predicted 391
9 SASI_Mm01_00125291 predicted 592
10 SASI_Mm01_00125293 predicted 288
11 SASI_Mm01_00125292 predicted 521
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152516
VALIDATED
COMMD1 MISSION shRNA Bacterial Glycerol Stock
copper metabolism (Murr1) domain containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152516.2-339s21c1
Sequence:CCGGATGAACCAGAGCCGCTGGAATCTCGAGATTCCAGCGGCTCTGGTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152516.2-256s21c1
Sequence:CCGGAGCAAGGTGGGATCACATCTGCTCGAGCAGATGTGATCCCACCTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152516.2-390s21c1
Sequence:CCGGGATGGCAAGTCTCAGTCAAGGCTCGAGCCTTGACTGAGACTTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152516.2-230s21c1
Sequence:CCGGGGCATTCTTGACTGCTCAAACCTCGAGGTTTGAGCAGTCAAGAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152516.2-112s21c1
Sequence:CCGGTGCTACGGAGCCAGCTATATCCTCGAGGATATAGCTGGCTCCGTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152516.2-563s21c1
Sequence:CCGGACTGATCAGCCAGCCTAACTGCTCGAGCAGTTAGGCTGGCTGATCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152516.1-415s1c1
Sequence:CCGGGCTCAAATACACACACCTGTTCTCGAGAACAGGTGTGTGTATTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152516.1-277s1c1
Sequence:CCGGCAAGCTGCTGTCATTTCCAAACTCGAGTTTGGAAATGACAGCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152516.1-507s1c1
Sequence:CCGGCAAAGTCAACCAAATTCTGAACTCGAGTTCAGAATTTGGTTGACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152516.1-501s1c1
Sequence:CCGGCGAGGTCAAAGTCAACCAAATCTCGAGATTTGGTTGACTTTGACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152516
VALIDATED
COMMD1 MISSION shRNA shRNA Plasmid DNA
copper metabolism (Murr1) domain containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152516.2-339s21c1
Sequence:CCGGATGAACCAGAGCCGCTGGAATCTCGAGATTCCAGCGGCTCTGGTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152516.2-256s21c1
Sequence:CCGGAGCAAGGTGGGATCACATCTGCTCGAGCAGATGTGATCCCACCTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152516.2-390s21c1
Sequence:CCGGGATGGCAAGTCTCAGTCAAGGCTCGAGCCTTGACTGAGACTTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152516.2-230s21c1
Sequence:CCGGGGCATTCTTGACTGCTCAAACCTCGAGGTTTGAGCAGTCAAGAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152516.2-112s21c1
Sequence:CCGGTGCTACGGAGCCAGCTATATCCTCGAGGATATAGCTGGCTCCGTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152516.2-563s21c1
Sequence:CCGGACTGATCAGCCAGCCTAACTGCTCGAGCAGTTAGGCTGGCTGATCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152516.1-415s1c1
Sequence:CCGGGCTCAAATACACACACCTGTTCTCGAGAACAGGTGTGTGTATTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152516.1-277s1c1
Sequence:CCGGCAAGCTGCTGTCATTTCCAAACTCGAGTTTGGAAATGACAGCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152516.1-507s1c1
Sequence:CCGGCAAAGTCAACCAAATTCTGAACTCGAGTTCAGAATTTGGTTGACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152516.1-501s1c1
Sequence:CCGGCGAGGTCAAAGTCAACCAAATCTCGAGATTTGGTTGACTTTGACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152516
VALIDATED
COMMD1 MISSION shRNA Lentiviral Transduction Particles
copper metabolism (Murr1) domain containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152516.2-339s21c1
Sequence:CCGGATGAACCAGAGCCGCTGGAATCTCGAGATTCCAGCGGCTCTGGTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152516.2-256s21c1
Sequence:CCGGAGCAAGGTGGGATCACATCTGCTCGAGCAGATGTGATCCCACCTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152516.2-390s21c1
Sequence:CCGGGATGGCAAGTCTCAGTCAAGGCTCGAGCCTTGACTGAGACTTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152516.2-230s21c1
Sequence:CCGGGGCATTCTTGACTGCTCAAACCTCGAGGTTTGAGCAGTCAAGAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152516.2-112s21c1
Sequence:CCGGTGCTACGGAGCCAGCTATATCCTCGAGGATATAGCTGGCTCCGTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152516.2-563s21c1
Sequence:CCGGACTGATCAGCCAGCCTAACTGCTCGAGCAGTTAGGCTGGCTGATCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152516.1-415s1c1
Sequence:CCGGGCTCAAATACACACACCTGTTCTCGAGAACAGGTGTGTGTATTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152516.1-277s1c1
Sequence:CCGGCAAGCTGCTGTCATTTCCAAACTCGAGTTTGGAAATGACAGCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152516.1-507s1c1
Sequence:CCGGCAAAGTCAACCAAATTCTGAACTCGAGTTCAGAATTTGGTTGACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152516.1-501s1c1
Sequence:CCGGCGAGGTCAAAGTCAACCAAATCTCGAGATTTGGTTGACTTTGACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144514
VALIDATED
COMMD1 MISSION shRNA Bacterial Glycerol Stock
copper metabolism (Murr1) domain containing 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_144514.2-206s21c1
Sequence:CCGGGTCTATTGCATCTGCAGACATCTCGAGATGTCTGCAGATGCAATAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144514.2-594s21c1
Sequence:CCGGTAACTGAAGAGAGTATCAATACTCGAGTATTGATACTCTCTTCAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_144514.2-442s21c1
Sequence:CCGGACAGCCCTGTTGCCATAATAGCTCGAGCTATTATGGCAACAGGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_144514.2-516s21c1
Sequence:CCGGGATGAAGTTAAAGTCAAGCAACTCGAGTTGCTTGACTTTAACTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144514.1-743s1c1
Sequence:CCGGGCATTCTTCTTCCGACTGGTACTCGAGTACCAGTCGGAAGAAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_144514.1-1193s1c1
Sequence:CCGGGATGAAGTTAAAGTCAAGCAACTCGAGTTGCTTGACTTTAACTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_144514.1-883s1c1
Sequence:CCGGGTCTATTGCATCTGCAGACATCTCGAGATGTCTGCAGATGCAATAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144514.1-880s1c1
Sequence:CCGGGCTGTCTATTGCATCTGCAGACTCGAGTCTGCAGATGCAATAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144514
VALIDATED
COMMD1 MISSION shRNA shRNA Plasmid DNA
copper metabolism (Murr1) domain containing 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_144514.2-206s21c1
Sequence:CCGGGTCTATTGCATCTGCAGACATCTCGAGATGTCTGCAGATGCAATAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144514.2-594s21c1
Sequence:CCGGTAACTGAAGAGAGTATCAATACTCGAGTATTGATACTCTCTTCAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_144514.2-442s21c1
Sequence:CCGGACAGCCCTGTTGCCATAATAGCTCGAGCTATTATGGCAACAGGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_144514.2-516s21c1
Sequence:CCGGGATGAAGTTAAAGTCAAGCAACTCGAGTTGCTTGACTTTAACTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144514.1-743s1c1
Sequence:CCGGGCATTCTTCTTCCGACTGGTACTCGAGTACCAGTCGGAAGAAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_144514.1-1193s1c1
Sequence:CCGGGATGAAGTTAAAGTCAAGCAACTCGAGTTGCTTGACTTTAACTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_144514.1-883s1c1
Sequence:CCGGGTCTATTGCATCTGCAGACATCTCGAGATGTCTGCAGATGCAATAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144514.1-880s1c1
Sequence:CCGGGCTGTCTATTGCATCTGCAGACTCGAGTCTGCAGATGCAATAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144514
VALIDATED
COMMD1 MISSION shRNA Lentiviral Transduction Particles
copper metabolism (Murr1) domain containing 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_144514.2-206s21c1
Sequence:CCGGGTCTATTGCATCTGCAGACATCTCGAGATGTCTGCAGATGCAATAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144514.2-594s21c1
Sequence:CCGGTAACTGAAGAGAGTATCAATACTCGAGTATTGATACTCTCTTCAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_144514.2-442s21c1
Sequence:CCGGACAGCCCTGTTGCCATAATAGCTCGAGCTATTATGGCAACAGGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_144514.2-516s21c1
Sequence:CCGGGATGAAGTTAAAGTCAAGCAACTCGAGTTGCTTGACTTTAACTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144514.1-743s1c1
Sequence:CCGGGCATTCTTCTTCCGACTGGTACTCGAGTACCAGTCGGAAGAAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_144514.1-1193s1c1
Sequence:CCGGGATGAAGTTAAAGTCAAGCAACTCGAGTTGCTTGACTTTAACTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_144514.1-883s1c1
Sequence:CCGGGTCTATTGCATCTGCAGACATCTCGAGATGTCTGCAGATGCAATAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144514.1-880s1c1
Sequence:CCGGGCTGTCTATTGCATCTGCAGACTCGAGTCTGCAGATGCAATAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks