EMAIL THIS PAGE TO A FRIEND

COMMD2

COMM domain containing 2

61 Gene Product Result for
UniProtKB ID: Q86X83, Q9H3L5, Q9Y5V1
Gene ID:
Mouse(52245) COMM domain containing 2
Rat(688478) COMM domain containing 2
Zebrafish(436694) COMM domain containing 2
cow(511081) COMM domain containing 2
domestic cat(101099238) COMM domain containing 2
dog(485713) COMM domain containing 2
chicken(425044) COMM domain containing 2
naked mole-rat(101723492) COMM domain containing 2
domestic guinea pig(100717124) COMM domain containing 2
sheep(101120624) COMM domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016094 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016094 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016094 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175095 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175095 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175095 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016094 Rosetta Predictions human pricing
NM_001109503 Rosetta Predictions rat pricing
NM_175095 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016094 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226313 predicted 225
2 SASI_Hs01_00226315 predicted 221
3 SASI_Hs01_00226316 predicted 405
4 SASI_Hs02_00348854 predicted 345
5 SASI_Hs01_00226317 predicted 482
6 SASI_Hs02_00348855 predicted 483
7 SASI_Hs01_00226319 predicted 424
8 SASI_Hs01_00226321 predicted 462
9 SASI_Hs01_00226322 predicted 453
10 SASI_Hs02_00348856 predicted 401
11 SASI_Hs01_00226314 predicted 368
12 SASI_Hs01_00226318 predicted 404
13 SASI_Hs01_00226320 predicted 380
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109503 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249039 predicted 805
2 SASI_Rn02_00249040 predicted 375
3 SASI_Rn02_00249041 predicted 809
4 SASI_Rn02_00249042 predicted 385
5 SASI_Rn02_00249043 predicted 502
6 SASI_Rn02_00249044 predicted 793
7 SASI_Rn02_00249045 predicted 207
8 SASI_Rn02_00249046 predicted 370
9 SASI_Rn02_00249047 predicted 785
10 SASI_Rn02_00249048 predicted 211
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175095 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345687 predicted 284
2 SASI_Mm01_00128588 predicted 456
3 SASI_Mm01_00128589 predicted 474
4 SASI_Mm01_00128590 predicted 361
5 SASI_Mm01_00128591 predicted 349
6 SASI_Mm01_00128592 predicted 212
7 SASI_Mm01_00128593 predicted 375
8 SASI_Mm01_00128594 predicted 348
9 SASI_Mm01_00128595 predicted 533
10 SASI_Mm01_00128597 predicted 332
11 SASI_Mm01_00128596 predicted 310
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016094
VALIDATED
COMMD2 MISSION shRNA Bacterial Glycerol Stock
COMM domain containing 2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434018    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016094.2-748s21c1
Sequence:CCGGTACATAGTATTCCTCAGTATCCTCGAGGATACTGAGGAATACTATGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016094.2-261s21c1
Sequence:CCGGAGCTCAAAGCTCATGATTTCTCTCGAGAGAAATCATGAGCTTTGAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016094.2-463s21c1
Sequence:CCGGGTCTCAGGCAACAGATTAAACCTCGAGGTTTAATCTGTTGCCTGAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016094.2-592s21c1
Sequence:CCGGCATTGGAAGAGATGAAGACAACTCGAGTTGTCTTCATCTCTTCCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016094.2-229s21c1
Sequence:CCGGGTGTGGAAGGATTAACGTATCCTCGAGGATACGTTAATCCTTCCACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016094.2-689s21c1
Sequence:CCGGTTGATGATATACAGCAATTACCTCGAGGTAATTGCTGTATATCATCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016094.2-285s21c1
Sequence:CCGGCTGGATTTCCAAGACTCTGTTCTCGAGAACAGAGTCTTGGAAATCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016094.2-420s1c1
Sequence:CCGGCATAACCTTGAATGGCGACTACTCGAGTAGTCGCCATTCAAGGTTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143111    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016094.2-407s1c1
Sequence:CCGGCCTTCCCAGTTATCATAACCTCTCGAGAGGTTATGATAACTGGGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016094.2-411s1c1
Sequence:CCGGCCCAGTTATCATAACCTTGAACTCGAGTTCAAGGTTATGATAACTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016094.2-567s1c1
Sequence:CCGGCATTTGGTTCAACAACTGGAACTCGAGTTCCAGTTGTTGAACCAAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016094.2-623s1c1
Sequence:CCGGGAGAGTTGTTCGCAACATCAACTCGAGTTGATGTTGCGAACAACTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016094.2-489s1c1
Sequence:CCGGGTGACTATAAAGCTACACCTTCTCGAGAAGGTGTAGCTTTATAGTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016094
VALIDATED
COMMD2 MISSION shRNA shRNA Plasmid DNA
COMM domain containing 2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434018    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016094.2-748s21c1
Sequence:CCGGTACATAGTATTCCTCAGTATCCTCGAGGATACTGAGGAATACTATGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016094.2-261s21c1
Sequence:CCGGAGCTCAAAGCTCATGATTTCTCTCGAGAGAAATCATGAGCTTTGAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016094.2-463s21c1
Sequence:CCGGGTCTCAGGCAACAGATTAAACCTCGAGGTTTAATCTGTTGCCTGAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016094.2-592s21c1
Sequence:CCGGCATTGGAAGAGATGAAGACAACTCGAGTTGTCTTCATCTCTTCCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016094.2-229s21c1
Sequence:CCGGGTGTGGAAGGATTAACGTATCCTCGAGGATACGTTAATCCTTCCACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016094.2-689s21c1
Sequence:CCGGTTGATGATATACAGCAATTACCTCGAGGTAATTGCTGTATATCATCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016094.2-285s21c1
Sequence:CCGGCTGGATTTCCAAGACTCTGTTCTCGAGAACAGAGTCTTGGAAATCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016094.2-420s1c1
Sequence:CCGGCATAACCTTGAATGGCGACTACTCGAGTAGTCGCCATTCAAGGTTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143111    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016094.2-407s1c1
Sequence:CCGGCCTTCCCAGTTATCATAACCTCTCGAGAGGTTATGATAACTGGGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016094.2-411s1c1
Sequence:CCGGCCCAGTTATCATAACCTTGAACTCGAGTTCAAGGTTATGATAACTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016094.2-567s1c1
Sequence:CCGGCATTTGGTTCAACAACTGGAACTCGAGTTCCAGTTGTTGAACCAAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016094.2-623s1c1
Sequence:CCGGGAGAGTTGTTCGCAACATCAACTCGAGTTGATGTTGCGAACAACTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016094.2-489s1c1
Sequence:CCGGGTGACTATAAAGCTACACCTTCTCGAGAAGGTGTAGCTTTATAGTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016094
VALIDATED
COMMD2 MISSION shRNA Lentiviral Transduction Particles
COMM domain containing 2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434018    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016094.2-748s21c1
Sequence:CCGGTACATAGTATTCCTCAGTATCCTCGAGGATACTGAGGAATACTATGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016094.2-261s21c1
Sequence:CCGGAGCTCAAAGCTCATGATTTCTCTCGAGAGAAATCATGAGCTTTGAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016094.2-463s21c1
Sequence:CCGGGTCTCAGGCAACAGATTAAACCTCGAGGTTTAATCTGTTGCCTGAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016094.2-592s21c1
Sequence:CCGGCATTGGAAGAGATGAAGACAACTCGAGTTGTCTTCATCTCTTCCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016094.2-229s21c1
Sequence:CCGGGTGTGGAAGGATTAACGTATCCTCGAGGATACGTTAATCCTTCCACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016094.2-689s21c1
Sequence:CCGGTTGATGATATACAGCAATTACCTCGAGGTAATTGCTGTATATCATCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016094.2-285s21c1
Sequence:CCGGCTGGATTTCCAAGACTCTGTTCTCGAGAACAGAGTCTTGGAAATCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016094.2-420s1c1
Sequence:CCGGCATAACCTTGAATGGCGACTACTCGAGTAGTCGCCATTCAAGGTTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143111    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016094.2-407s1c1
Sequence:CCGGCCTTCCCAGTTATCATAACCTCTCGAGAGGTTATGATAACTGGGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016094.2-411s1c1
Sequence:CCGGCCCAGTTATCATAACCTTGAACTCGAGTTCAAGGTTATGATAACTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016094.2-567s1c1
Sequence:CCGGCATTTGGTTCAACAACTGGAACTCGAGTTCCAGTTGTTGAACCAAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016094.2-623s1c1
Sequence:CCGGGAGAGTTGTTCGCAACATCAACTCGAGTTGATGTTGCGAACAACTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016094.2-489s1c1
Sequence:CCGGGTGACTATAAAGCTACACCTTCTCGAGAAGGTGTAGCTTTATAGTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175095
VALIDATED
COMMD2 MISSION shRNA Bacterial Glycerol Stock
COMM domain containing 2
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_175095.4-444s1c1
Sequence:CCGGGAAGTCTCCGGCAACAGATTACTCGAGTAATCTGTTGCCGGAGACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_175095.4-208s1c1
Sequence:CCGGGCATGGTGTGGAAGGATTAACCTCGAGGTTAATCCTTCCACACCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175095.4-184s21c1
Sequence:CCGGGAACGTGAGTAGTGACACTATCTCGAGATAGTGTCACTACTCACGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175095.4-444s21c1
Sequence:CCGGGAAGTCTCCGGCAACAGATTACTCGAGTAATCTGTTGCCGGAGACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175095.4-272s21c1
Sequence:CCGGGATTTCCAAGACTCTGTCTTTCTCGAGAAAGACAGAGTCTTGGAAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175095.4-241s21c1
Sequence:CCGGCGAGAGCTCAAAGCTTATGATCTCGAGATCATAAGCTTTGAGCTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182180    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175095.2-513s1c1
Sequence:CCGGCGACCACAGCACTCATTTCTTCTCGAGAAGAAATGAGTGCTGTGGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_175095.2-249s1c1
Sequence:CCGGCGAGAGCTCAAAGCTTATGATCTCGAGATCATAAGCTTTGAGCTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175095.2-280s1c1
Sequence:CCGGGATTTCCAAGACTCTGTCTTTCTCGAGAAAGACAGAGTCTTGGAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175095.2-369s1c1
Sequence:CCGGCAGAACTATTCTGAACGAGTTCTCGAGAACTCGTTCAGAATAGTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176707    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175095.2-2170s1c1
Sequence:CCGGCCAACTGTTCTCATATTGATTCTCGAGAATCAATATGAGAACAGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177374    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175095.2-2218s1c1
Sequence:CCGGGCAAAGAAAGATTGTGAGTAACTCGAGTTACTCACAATCTTTCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175095.2-192s1c1
Sequence:CCGGGAACGTGAGTAGTGACACTATCTCGAGATAGTGTCACTACTCACGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197777    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175095.2-1000s1c1
Sequence:CCGGGCACTATACAATTACAGCCATCTCGAGATGGCTGTAATTGTATAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_175095.2-250s1c1
Sequence:CCGGGAGAGCTCAAAGCTTATGATTCTCGAGAATCATAAGCTTTGAGCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175095
VALIDATED
COMMD2 MISSION shRNA shRNA Plasmid DNA
COMM domain containing 2
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_175095.4-444s1c1
Sequence:CCGGGAAGTCTCCGGCAACAGATTACTCGAGTAATCTGTTGCCGGAGACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_175095.4-208s1c1
Sequence:CCGGGCATGGTGTGGAAGGATTAACCTCGAGGTTAATCCTTCCACACCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175095.4-184s21c1
Sequence:CCGGGAACGTGAGTAGTGACACTATCTCGAGATAGTGTCACTACTCACGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175095.4-444s21c1
Sequence:CCGGGAAGTCTCCGGCAACAGATTACTCGAGTAATCTGTTGCCGGAGACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175095.4-272s21c1
Sequence:CCGGGATTTCCAAGACTCTGTCTTTCTCGAGAAAGACAGAGTCTTGGAAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175095.4-241s21c1
Sequence:CCGGCGAGAGCTCAAAGCTTATGATCTCGAGATCATAAGCTTTGAGCTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182180    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175095.2-513s1c1
Sequence:CCGGCGACCACAGCACTCATTTCTTCTCGAGAAGAAATGAGTGCTGTGGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_175095.2-249s1c1
Sequence:CCGGCGAGAGCTCAAAGCTTATGATCTCGAGATCATAAGCTTTGAGCTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175095.2-280s1c1
Sequence:CCGGGATTTCCAAGACTCTGTCTTTCTCGAGAAAGACAGAGTCTTGGAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175095.2-369s1c1
Sequence:CCGGCAGAACTATTCTGAACGAGTTCTCGAGAACTCGTTCAGAATAGTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176707    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175095.2-2170s1c1
Sequence:CCGGCCAACTGTTCTCATATTGATTCTCGAGAATCAATATGAGAACAGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177374    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175095.2-2218s1c1
Sequence:CCGGGCAAAGAAAGATTGTGAGTAACTCGAGTTACTCACAATCTTTCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175095.2-192s1c1
Sequence:CCGGGAACGTGAGTAGTGACACTATCTCGAGATAGTGTCACTACTCACGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197777    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175095.2-1000s1c1
Sequence:CCGGGCACTATACAATTACAGCCATCTCGAGATGGCTGTAATTGTATAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_175095.2-250s1c1
Sequence:CCGGGAGAGCTCAAAGCTTATGATTCTCGAGAATCATAAGCTTTGAGCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175095
VALIDATED
COMMD2 MISSION shRNA Lentiviral Transduction Particles
COMM domain containing 2
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_175095.4-444s1c1
Sequence:CCGGGAAGTCTCCGGCAACAGATTACTCGAGTAATCTGTTGCCGGAGACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_175095.4-208s1c1
Sequence:CCGGGCATGGTGTGGAAGGATTAACCTCGAGGTTAATCCTTCCACACCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175095.4-184s21c1
Sequence:CCGGGAACGTGAGTAGTGACACTATCTCGAGATAGTGTCACTACTCACGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175095.4-444s21c1
Sequence:CCGGGAAGTCTCCGGCAACAGATTACTCGAGTAATCTGTTGCCGGAGACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175095.4-272s21c1
Sequence:CCGGGATTTCCAAGACTCTGTCTTTCTCGAGAAAGACAGAGTCTTGGAAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175095.4-241s21c1
Sequence:CCGGCGAGAGCTCAAAGCTTATGATCTCGAGATCATAAGCTTTGAGCTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182180    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175095.2-513s1c1
Sequence:CCGGCGACCACAGCACTCATTTCTTCTCGAGAAGAAATGAGTGCTGTGGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_175095.2-249s1c1
Sequence:CCGGCGAGAGCTCAAAGCTTATGATCTCGAGATCATAAGCTTTGAGCTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175095.2-280s1c1
Sequence:CCGGGATTTCCAAGACTCTGTCTTTCTCGAGAAAGACAGAGTCTTGGAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175095.2-369s1c1
Sequence:CCGGCAGAACTATTCTGAACGAGTTCTCGAGAACTCGTTCAGAATAGTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176707    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175095.2-2170s1c1
Sequence:CCGGCCAACTGTTCTCATATTGATTCTCGAGAATCAATATGAGAACAGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177374    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175095.2-2218s1c1
Sequence:CCGGGCAAAGAAAGATTGTGAGTAACTCGAGTTACTCACAATCTTTCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175095.2-192s1c1
Sequence:CCGGGAACGTGAGTAGTGACACTATCTCGAGATAGTGTCACTACTCACGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197777    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175095.2-1000s1c1
Sequence:CCGGGCACTATACAATTACAGCCATCTCGAGATGGCTGTAATTGTATAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_175095.2-250s1c1
Sequence:CCGGGAGAGCTCAAAGCTTATGATTCTCGAGAATCATAAGCTTTGAGCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)