EMAIL THIS PAGE TO A FRIEND

COMMD3

COMM domain containing 3

125 Gene Product Result for
Synonyms: BUP C10orf8
UniProtKB ID: Q9UBI1, D3DRU7, Q5T8Y9
Gene ID:
Mouse(12238) COMM domain containing 3
Rat(291339) COMM domain containing 3
Zebrafish(494135) COMM domain containing 3
cow(767926) COMM domain containing 3
domestic cat(101095905) COMM domain containing 3
dog(477977) COMM domain containing 3
chicken(101749710) COMM domain containing 3
chicken(420507) COMM domain containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012071 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012071 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012071 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_147778 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_147778 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_147778 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012071 Rosetta Predictions human pricing
NM_198732 Rosetta Predictions rat pricing
XM_001073695 Rosetta Predictions rat pricing
NM_147778 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012071 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199709 predicted 343
2 SASI_Hs02_00343538 predicted 701
3 SASI_Hs02_00343539 predicted 271
4 SASI_Hs01_00199711 predicted 363
5 SASI_Hs01_00199712 predicted 459
6 SASI_Hs02_00343540 predicted 700
7 SASI_Hs02_00343541 predicted 551
8 SASI_Hs02_00343542 predicted 348
9 SASI_Hs01_00199713 predicted 558
10 SASI_Hs02_00343543 predicted 370
11 SASI_Hs01_00199704 predicted 210
12 SASI_Hs01_00199705 predicted 404
13 SASI_Hs01_00199706 predicted 284
14 SASI_Hs01_00199707 predicted 295
15 SASI_Hs01_00199708 predicted 279
16 SASI_Hs01_00199710 predicted 487
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198732 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036366 predicted 471
2 SASI_Rn01_00036367 predicted 269
3 SASI_Rn01_00036368 predicted 199
4 SASI_Rn01_00036369 predicted 394
5 SASI_Rn01_00036370 predicted 554
6 SASI_Rn01_00036371 predicted 270
7 SASI_Rn01_00036372 predicted 642
8 SASI_Rn02_00269940 predicted 581
9 SASI_Rn01_00036373 predicted 520
10 SASI_Rn01_00036374 predicted 275
11 SASI_Rn01_00036375 predicted 526
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073695 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00343585 predicted 731
2 SASI_Rn02_00343586 predicted 645
3 SASI_Rn02_00343587 predicted 776
4 SASI_Rn02_00343588 predicted 804
5 SASI_Rn02_00343589 predicted 839
6 SASI_Rn02_00343590 predicted 704
7 SASI_Rn02_00343591 predicted 632
8 SASI_Rn02_00343592 predicted 685
9 SASI_Rn02_00343593 predicted 597
10 SASI_Rn02_00343594 predicted 866
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147778 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173998 predicted 219
2 SASI_Mm01_00173999 predicted 226
3 SASI_Mm01_00174001 predicted 426
4 SASI_Mm01_00174002 predicted 225
5 SASI_Mm01_00174004 predicted 566
6 SASI_Mm01_00174005 predicted 479
7 SASI_Mm01_00174006 predicted 413
8 SASI_Mm01_00174007 predicted 304
9 SASI_Mm02_00342712 predicted 473
10 SASI_Mm02_00342713 predicted 500
11 SASI_Mm01_00174000 predicted 444
12 SASI_Mm01_00174003 predicted 355
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012071
VALIDATED
COMMD3 MISSION shRNA Bacterial Glycerol Stock
COMM domain containing 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012071.1-366s1c1
Sequence:CCGGGCAGATCTCTCCCTCATATAACTCGAGTTATATGAGGGAGAGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012071.1-203s1c1
Sequence:CCGGGCAGCTGCAACTTACATACTACTCGAGTAGTATGTAAGTTGCAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012071.1-421s1c1
Sequence:CCGGGACCAATCAACTTCATAGGATCTCGAGATCCTATGAAGTTGATTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012071.1-142s1c1
Sequence:CCGGCGTGTTAGATCATCCAGACTTCTCGAGAAGTCTGGATGATCTAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012071.1-213s1c1
Sequence:CCGGCTTACATACTAGAGGCAGGAACTCGAGTTCCTGCCTCTAGTATGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323371    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012071.2-691s21c1
Sequence:CCGGCTTCAGCTGAACCACCGTTTGCTCGAGCAAACGGTGGTTCAGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012071.2-404s21c1
Sequence:CCGGGCAGATCTCTCCCTCATATAACTCGAGTTATATGAGGGAGAGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012071.2-235s21c1
Sequence:CCGGCATGCAGCAGCTGCAACTTACCTCGAGGTAAGTTGCAGCTGCTGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012071.2-437s21c1
Sequence:CCGGGGCGCTTGGAATATCAGATAACTCGAGTTATCTGATATTCCAAGCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012071.2-459s21c1
Sequence:CCGGGACCAATCAACTTCATAGGATCTCGAGATCCTATGAAGTTGATTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012071
VALIDATED
COMMD3 MISSION shRNA shRNA Plasmid DNA
COMM domain containing 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012071.1-366s1c1
Sequence:CCGGGCAGATCTCTCCCTCATATAACTCGAGTTATATGAGGGAGAGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012071.1-203s1c1
Sequence:CCGGGCAGCTGCAACTTACATACTACTCGAGTAGTATGTAAGTTGCAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012071.1-421s1c1
Sequence:CCGGGACCAATCAACTTCATAGGATCTCGAGATCCTATGAAGTTGATTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012071.1-142s1c1
Sequence:CCGGCGTGTTAGATCATCCAGACTTCTCGAGAAGTCTGGATGATCTAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012071.1-213s1c1
Sequence:CCGGCTTACATACTAGAGGCAGGAACTCGAGTTCCTGCCTCTAGTATGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323371    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012071.2-691s21c1
Sequence:CCGGCTTCAGCTGAACCACCGTTTGCTCGAGCAAACGGTGGTTCAGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012071.2-404s21c1
Sequence:CCGGGCAGATCTCTCCCTCATATAACTCGAGTTATATGAGGGAGAGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012071.2-235s21c1
Sequence:CCGGCATGCAGCAGCTGCAACTTACCTCGAGGTAAGTTGCAGCTGCTGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012071.2-437s21c1
Sequence:CCGGGGCGCTTGGAATATCAGATAACTCGAGTTATCTGATATTCCAAGCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012071.2-459s21c1
Sequence:CCGGGACCAATCAACTTCATAGGATCTCGAGATCCTATGAAGTTGATTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012071
VALIDATED
COMMD3 MISSION shRNA Lentiviral Transduction Particles
COMM domain containing 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012071.1-366s1c1
Sequence:CCGGGCAGATCTCTCCCTCATATAACTCGAGTTATATGAGGGAGAGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012071.1-203s1c1
Sequence:CCGGGCAGCTGCAACTTACATACTACTCGAGTAGTATGTAAGTTGCAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012071.1-421s1c1
Sequence:CCGGGACCAATCAACTTCATAGGATCTCGAGATCCTATGAAGTTGATTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012071.1-142s1c1
Sequence:CCGGCGTGTTAGATCATCCAGACTTCTCGAGAAGTCTGGATGATCTAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012071.1-213s1c1
Sequence:CCGGCTTACATACTAGAGGCAGGAACTCGAGTTCCTGCCTCTAGTATGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323371    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012071.2-691s21c1
Sequence:CCGGCTTCAGCTGAACCACCGTTTGCTCGAGCAAACGGTGGTTCAGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012071.2-404s21c1
Sequence:CCGGGCAGATCTCTCCCTCATATAACTCGAGTTATATGAGGGAGAGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012071.2-235s21c1
Sequence:CCGGCATGCAGCAGCTGCAACTTACCTCGAGGTAAGTTGCAGCTGCTGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012071.2-437s21c1
Sequence:CCGGGGCGCTTGGAATATCAGATAACTCGAGTTATCTGATATTCCAAGCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012071.2-459s21c1
Sequence:CCGGGACCAATCAACTTCATAGGATCTCGAGATCCTATGAAGTTGATTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_147778
VALIDATED
COMMD3 MISSION shRNA Bacterial Glycerol Stock
COMM domain containing 3
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000202293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_147778.2-394s1c1
Sequence:CCGGGCGCTTGGAGTACCAGATAAACTCGAGTTTATCTGGTACTCCAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_147778.2-417s1c1
Sequence:CCGGCCAACCAACTTCATAAGATGTCTCGAGACATCTTATGAAGTTGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_147778.2-472s1c1
Sequence:CCGGGAACAATGATTCCCAATCCTACTCGAGTAGGATTGGGAATCATTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_147778.2-306s1c1
Sequence:CCGGGCACCGAGTATCAGAACAATACTCGAGTATTGTTCTGATACTCGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_147778
VALIDATED
COMMD3 MISSION shRNA shRNA Plasmid DNA
COMM domain containing 3
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000202293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_147778.2-394s1c1
Sequence:CCGGGCGCTTGGAGTACCAGATAAACTCGAGTTTATCTGGTACTCCAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_147778.2-417s1c1
Sequence:CCGGCCAACCAACTTCATAAGATGTCTCGAGACATCTTATGAAGTTGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_147778.2-472s1c1
Sequence:CCGGGAACAATGATTCCCAATCCTACTCGAGTAGGATTGGGAATCATTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_147778.2-306s1c1
Sequence:CCGGGCACCGAGTATCAGAACAATACTCGAGTATTGTTCTGATACTCGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_147778
VALIDATED
COMMD3 MISSION shRNA Lentiviral Transduction Particles
COMM domain containing 3
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000202293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_147778.2-394s1c1
Sequence:CCGGGCGCTTGGAGTACCAGATAAACTCGAGTTTATCTGGTACTCCAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_147778.2-417s1c1
Sequence:CCGGCCAACCAACTTCATAAGATGTCTCGAGACATCTTATGAAGTTGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_147778.2-472s1c1
Sequence:CCGGGAACAATGATTCCCAATCCTACTCGAGTAGGATTGGGAATCATTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_147778.2-306s1c1
Sequence:CCGGGCACCGAGTATCAGAACAATACTCGAGTATTGTTCTGATACTCGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks