EMAIL THIS PAGE TO A FRIEND

COMMD4

COMM domain containing 4

46 Gene Product Result for
UniProtKB ID: Q9H0A8, B2RBN4, Q7L637, Q9NX43
Gene ID:
Mouse(66199) COMM domain containing 4
Rat(363068) COMM domain containing 4
Zebrafish(767771) COMM domain containing 4
chicken(770048) COMM domain containing 4
domestic cat(101080292) COMM domain containing 4
cow(616960) COMM domain containing 4
dog(612915) COMM domain containing 4
domestic guinea pig(100735989) COMM domain containing 4
naked mole-rat(101716277) COMM domain containing 4
sheep(101106628) COMM domain containing 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017828 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017828 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017828 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025417 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025417 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025417 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU087081 MISSION® esiRNA esiRNA targeting mouse Commd4 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017828 Rosetta Predictions human pricing
NM_001108762 Rosetta Predictions rat pricing
NM_025417 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017828 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078312 predicted 570
2 SASI_Hs01_00078313 predicted 423
3 SASI_Hs01_00078314 predicted 660
4 SASI_Hs01_00078315 predicted 566
5 SASI_Hs01_00078316 predicted 579
6 SASI_Hs01_00078317 predicted 561
7 SASI_Hs01_00078318 predicted 581
8 SASI_Hs01_00078319 predicted 790
9 SASI_Hs01_00078320 predicted 822
10 SASI_Hs02_00350701 predicted 828
11 SASI_Hs01_00078321 predicted 66
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108762 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241835 predicted 210
2 SASI_Rn02_00241836 predicted 545
3 SASI_Rn02_00241837 predicted 324
4 SASI_Rn02_00241838 predicted 393
5 SASI_Rn02_00241839 predicted 497
6 SASI_Rn02_00241840 predicted 543
7 SASI_Rn02_00241841 predicted 490
8 SASI_Rn02_00241842 predicted 215
9 SASI_Rn02_00241843 predicted 379
10 SASI_Rn02_00241844 predicted 208
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025417 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039991 predicted 200
2 SASI_Mm01_00039992 predicted 258
3 SASI_Mm01_00039993 predicted 278
4 SASI_Mm01_00039994 predicted 476
5 SASI_Mm01_00039995 predicted 504
6 SASI_Mm01_00039996 predicted 540
7 SASI_Mm02_00328196 predicted 452
8 SASI_Mm01_00039997 predicted 595
9 SASI_Mm01_00039998 predicted 279
10 SASI_Mm01_00039999 predicted 552
11 SASI_Mm01_00040000 predicted 245
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017828
VALIDATED
COMMD4 MISSION shRNA Bacterial Glycerol Stock
COMM domain containing 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017828.3-225s21c1
Sequence:CCGGTGACGCCAAGTTTGAGTCAGGCTCGAGCCTGACTCAAACTTGGCGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017828.3-576s21c1
Sequence:CCGGCATGTCCCTCTCAGCAGACAACTCGAGTTGTCTGCTGAGAGGGACATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017828.3-492s21c1
Sequence:CCGGCCTGCTGCAATCCGTGGAAGACTCGAGTCTTCCACGGATTGCAGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017828.3-108s21c1
Sequence:CCGGAGAAATCAGCACGCTGGCCAACTCGAGTTGGCCAGCGTGCTGATTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143932    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017828.2-1188s1c1
Sequence:CCGGCCAGAACTGTGAGAAAGAAATCTCGAGATTTCTTTCTCACAGTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017828.2-337s1c1
Sequence:CCGGGCTGTTATGAGGAGAAGCAAACTCGAGTTTGCTTCTCCTCATAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_017828.2-191s1c1
Sequence:CCGGGTTTGAGTCAGGCGATGTGAACTCGAGTTCACATCGCCTGACTCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_017828.2-223s1c1
Sequence:CCGGCAGTGCTGAGTTTCATCCTCTCTCGAGAGAGGATGAAACTCAGCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142065    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017828.2-753s1c1
Sequence:CCGGGCCTCACTTCTCTCTTGAGAACTCGAGTTCTCAAGAGAGAAGTGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017828
VALIDATED
COMMD4 MISSION shRNA shRNA Plasmid DNA
COMM domain containing 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017828.3-225s21c1
Sequence:CCGGTGACGCCAAGTTTGAGTCAGGCTCGAGCCTGACTCAAACTTGGCGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017828.3-576s21c1
Sequence:CCGGCATGTCCCTCTCAGCAGACAACTCGAGTTGTCTGCTGAGAGGGACATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017828.3-492s21c1
Sequence:CCGGCCTGCTGCAATCCGTGGAAGACTCGAGTCTTCCACGGATTGCAGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017828.3-108s21c1
Sequence:CCGGAGAAATCAGCACGCTGGCCAACTCGAGTTGGCCAGCGTGCTGATTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143932    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017828.2-1188s1c1
Sequence:CCGGCCAGAACTGTGAGAAAGAAATCTCGAGATTTCTTTCTCACAGTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017828.2-337s1c1
Sequence:CCGGGCTGTTATGAGGAGAAGCAAACTCGAGTTTGCTTCTCCTCATAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_017828.2-191s1c1
Sequence:CCGGGTTTGAGTCAGGCGATGTGAACTCGAGTTCACATCGCCTGACTCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_017828.2-223s1c1
Sequence:CCGGCAGTGCTGAGTTTCATCCTCTCTCGAGAGAGGATGAAACTCAGCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142065    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017828.2-753s1c1
Sequence:CCGGGCCTCACTTCTCTCTTGAGAACTCGAGTTCTCAAGAGAGAAGTGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017828
VALIDATED
COMMD4 MISSION shRNA Lentiviral Transduction Particles
COMM domain containing 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017828.3-225s21c1
Sequence:CCGGTGACGCCAAGTTTGAGTCAGGCTCGAGCCTGACTCAAACTTGGCGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017828.3-576s21c1
Sequence:CCGGCATGTCCCTCTCAGCAGACAACTCGAGTTGTCTGCTGAGAGGGACATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017828.3-492s21c1
Sequence:CCGGCCTGCTGCAATCCGTGGAAGACTCGAGTCTTCCACGGATTGCAGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017828.3-108s21c1
Sequence:CCGGAGAAATCAGCACGCTGGCCAACTCGAGTTGGCCAGCGTGCTGATTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143932    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017828.2-1188s1c1
Sequence:CCGGCCAGAACTGTGAGAAAGAAATCTCGAGATTTCTTTCTCACAGTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017828.2-337s1c1
Sequence:CCGGGCTGTTATGAGGAGAAGCAAACTCGAGTTTGCTTCTCCTCATAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_017828.2-191s1c1
Sequence:CCGGGTTTGAGTCAGGCGATGTGAACTCGAGTTCACATCGCCTGACTCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_017828.2-223s1c1
Sequence:CCGGCAGTGCTGAGTTTCATCCTCTCTCGAGAGAGGATGAAACTCAGCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142065    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017828.2-753s1c1
Sequence:CCGGGCCTCACTTCTCTCTTGAGAACTCGAGTTCTCAAGAGAGAAGTGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025417
COMMD4 MISSION shRNA Bacterial Glycerol Stock
COMM domain containing 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000340174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025417.2-278s21c1
Sequence:CCGGGACAGTGATTCCTTGTCCAGTCTCGAGACTGGACAAGGAATCACTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025417.2-122s21c1
Sequence:CCGGCTGTGTAGCCAGGTGCTAAAGCTCGAGCTTTAGCACCTGGCTACACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025417.2-202s21c1
Sequence:CCGGGTTTGAGTCTGGAGACGTGAACTCGAGTTCACGTCTCCAGACTCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025417.2-343s21c1
Sequence:CCGGGTGCCGCTGTTACGAAGAGAACTCGAGTTCTCTTCGTAACAGCGGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025417.2-491s21c1
Sequence:CCGGCATCTGCAGCTACAGGTTGTGCTCGAGCACAACCTGTAGCTGCAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025417.2-599s21c1
Sequence:CCGGCAGACCATGATGACTGCTTTGCTCGAGCAAAGCAGTCATCATGGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025417.1-279s1c1
Sequence:CCGGGACAGTGATTCCTTGTCCAGTCTCGAGACTGGACAAGGAATCACTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025417.1-203s1c1
Sequence:CCGGGTTTGAGTCTGGAGACGTGAACTCGAGTTCACGTCTCCAGACTCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025417.1-182s1c1
Sequence:CCGGGAAGCTTACTGCTGATGCCAACTCGAGTTGGCATCAGCAGTAAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025417.1-190s1c1
Sequence:CCGGCTGCTGATGCCAAGTTTGAGTCTCGAGACTCAAACTTGGCATCAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025417
COMMD4 MISSION shRNA shRNA Plasmid DNA
COMM domain containing 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000340174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025417.2-278s21c1
Sequence:CCGGGACAGTGATTCCTTGTCCAGTCTCGAGACTGGACAAGGAATCACTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025417.2-122s21c1
Sequence:CCGGCTGTGTAGCCAGGTGCTAAAGCTCGAGCTTTAGCACCTGGCTACACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025417.2-202s21c1
Sequence:CCGGGTTTGAGTCTGGAGACGTGAACTCGAGTTCACGTCTCCAGACTCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025417.2-343s21c1
Sequence:CCGGGTGCCGCTGTTACGAAGAGAACTCGAGTTCTCTTCGTAACAGCGGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025417.2-491s21c1
Sequence:CCGGCATCTGCAGCTACAGGTTGTGCTCGAGCACAACCTGTAGCTGCAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025417.2-599s21c1
Sequence:CCGGCAGACCATGATGACTGCTTTGCTCGAGCAAAGCAGTCATCATGGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025417.1-279s1c1
Sequence:CCGGGACAGTGATTCCTTGTCCAGTCTCGAGACTGGACAAGGAATCACTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025417.1-203s1c1
Sequence:CCGGGTTTGAGTCTGGAGACGTGAACTCGAGTTCACGTCTCCAGACTCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025417.1-182s1c1
Sequence:CCGGGAAGCTTACTGCTGATGCCAACTCGAGTTGGCATCAGCAGTAAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025417.1-190s1c1
Sequence:CCGGCTGCTGATGCCAAGTTTGAGTCTCGAGACTCAAACTTGGCATCAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025417
COMMD4 MISSION shRNA Lentiviral Transduction Particles
COMM domain containing 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000340174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025417.2-278s21c1
Sequence:CCGGGACAGTGATTCCTTGTCCAGTCTCGAGACTGGACAAGGAATCACTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025417.2-122s21c1
Sequence:CCGGCTGTGTAGCCAGGTGCTAAAGCTCGAGCTTTAGCACCTGGCTACACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025417.2-202s21c1
Sequence:CCGGGTTTGAGTCTGGAGACGTGAACTCGAGTTCACGTCTCCAGACTCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025417.2-343s21c1
Sequence:CCGGGTGCCGCTGTTACGAAGAGAACTCGAGTTCTCTTCGTAACAGCGGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025417.2-491s21c1
Sequence:CCGGCATCTGCAGCTACAGGTTGTGCTCGAGCACAACCTGTAGCTGCAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025417.2-599s21c1
Sequence:CCGGCAGACCATGATGACTGCTTTGCTCGAGCAAAGCAGTCATCATGGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025417.1-279s1c1
Sequence:CCGGGACAGTGATTCCTTGTCCAGTCTCGAGACTGGACAAGGAATCACTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025417.1-203s1c1
Sequence:CCGGGTTTGAGTCTGGAGACGTGAACTCGAGTTCACGTCTCCAGACTCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025417.1-182s1c1
Sequence:CCGGGAAGCTTACTGCTGATGCCAACTCGAGTTGGCATCAGCAGTAAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025417.1-190s1c1
Sequence:CCGGCTGCTGATGCCAAGTTTGAGTCTCGAGACTCAAACTTGGCATCAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)