EMAIL THIS PAGE TO A FRIEND

COMMD5

COMM domain containing 5

78 Gene Product Result for
Synonyms: HCARG
UniProtKB ID: Q9GZQ3, D3DWN7, Q9NVN6, Q9UHX5
Gene ID:
Mouse(66398) COMM domain containing 5
Rat(245974) COMM domain containing 5
sheep(101116237) COMM domain containing 5
Zebrafish(445159) COMM domain containing 5
chicken(422376) COMM domain containing 5
cow(504807) COMM domain containing 5
domestic cat(101083400) COMM domain containing 5
dog(482105) COMM domain containing 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025536 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025536 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025536 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014066 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014066 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014066 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001081003 Rosetta Predictions human pricing
NM_001081004 Rosetta Predictions human pricing
NM_014066 Rosetta Predictions human pricing
NM_139108 Rosetta Predictions rat pricing
NM_025536 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081003 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316283 predicted 532
2 SASI_Hs02_00316284 predicted 777
3 SASI_Hs02_00316285 predicted 535
4 SASI_Hs02_00316286 predicted 549
5 SASI_Hs02_00316287 predicted 704
6 SASI_Hs02_00316288 predicted 604
7 SASI_Hs02_00316289 predicted 786
8 SASI_Hs02_00316290 predicted 546
9 SASI_Hs02_00316291 predicted 812
10 SASI_Hs02_00316292 predicted 784
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081004 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316293 predicted 435
2 SASI_Hs02_00316294 predicted 671
3 SASI_Hs02_00316295 predicted 438
4 SASI_Hs02_00316296 predicted 451
5 SASI_Hs02_00316297 predicted 602
6 SASI_Hs02_00316298 predicted 498
7 SASI_Hs02_00316299 predicted 679
8 SASI_Hs02_00316300 predicted 442
9 SASI_Hs02_00316301 predicted 703
10 SASI_Hs02_00316302 predicted 680
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014066 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074007 predicted 590
2 SASI_Hs02_00345086 predicted 831
3 SASI_Hs02_00345087 predicted 592
4 SASI_Hs02_00345088 predicted 601
5 SASI_Hs02_00345089 predicted 756
6 SASI_Hs02_00345090 predicted 655
7 SASI_Hs02_00345091 predicted 840
8 SASI_Hs02_00345092 predicted 596
9 SASI_Hs02_00345093 predicted 864
10 SASI_Hs02_00345094 predicted 831
11 SASI_Hs01_00074003 predicted 261
12 SASI_Hs01_00074004 predicted 372
13 SASI_Hs01_00074005 predicted 1015
14 SASI_Hs01_00074006 predicted 955
15 SASI_Hs01_00074008 predicted 908
16 SASI_Hs01_00074009 predicted 281
17 SASI_Hs01_00074010 predicted 885
18 SASI_Hs01_00074011 predicted 875
19 SASI_Hs01_00074012 predicted 776
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139108 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076145 predicted 474
2 SASI_Rn01_00076146 predicted 643
3 SASI_Rn01_00076147 predicted 265
4 SASI_Rn01_00076148 predicted 323
5 SASI_Rn01_00076149 predicted 262
6 SASI_Rn01_00076150 predicted 273
7 SASI_Rn02_00268486 predicted 264
8 SASI_Rn01_00076151 predicted 792
9 SASI_Rn01_00076152 predicted 526
10 SASI_Rn01_00076153 predicted 237
11 SASI_Rn01_00076154 predicted 674
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025536 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00157524 predicted 738
2 SASI_Mm01_00157525 predicted 623
3 SASI_Mm01_00157526 predicted 755
4 SASI_Mm01_00157527 predicted 475
5 SASI_Mm01_00157529 predicted 365
6 SASI_Mm01_00157530 predicted 501
7 SASI_Mm01_00157532 predicted 740
8 SASI_Mm02_00328458 predicted 587
9 SASI_Mm01_00157533 predicted 249
10 SASI_Mm02_00328459 predicted 218
11 SASI_Mm01_00157528 predicted 249
12 SASI_Mm01_00157531 predicted 483
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025536
VALIDATED
COMMD5 MISSION shRNA Bacterial Glycerol Stock
COMM domain containing 5
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025536.1-463s1c1
Sequence:CCGGCCAAGATATGATTGGAGATCTCTCGAGAGATCTCCAATCATATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025536.1-243s1c1
Sequence:CCGGGCACCTTCAGAAAGTTGTTGACTCGAGTCAACAACTTTCTGAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025536.1-628s1c1
Sequence:CCGGGAGTGTTCTCATGCAGCTGAACTCGAGTTCAGCTGCATGAGAACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251045    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025536.2-824s21c1
Sequence:CCGGCGCACTGGTGATGAGGATGTACTCGAGTACATCCTCATCACCAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025536.2-133s21c1
Sequence:CCGGTACTTACACCATCCAACTGACCTCGAGGTCAGTTGGATGGTGTAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025536.2-749s21c1
Sequence:CCGGAGAGAAAGTGTGAGCGCAAACCTCGAGGTTTGCGCTCACACTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025536.2-674s21c1
Sequence:CCGGTCGAGGTGCCCATAGCCAAATCTCGAGATTTGGCTATGGGCACCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025536
VALIDATED
COMMD5 MISSION shRNA shRNA Plasmid DNA
COMM domain containing 5
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025536.1-463s1c1
Sequence:CCGGCCAAGATATGATTGGAGATCTCTCGAGAGATCTCCAATCATATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025536.1-243s1c1
Sequence:CCGGGCACCTTCAGAAAGTTGTTGACTCGAGTCAACAACTTTCTGAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025536.1-628s1c1
Sequence:CCGGGAGTGTTCTCATGCAGCTGAACTCGAGTTCAGCTGCATGAGAACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251045    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025536.2-824s21c1
Sequence:CCGGCGCACTGGTGATGAGGATGTACTCGAGTACATCCTCATCACCAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025536.2-133s21c1
Sequence:CCGGTACTTACACCATCCAACTGACCTCGAGGTCAGTTGGATGGTGTAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025536.2-749s21c1
Sequence:CCGGAGAGAAAGTGTGAGCGCAAACCTCGAGGTTTGCGCTCACACTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025536.2-674s21c1
Sequence:CCGGTCGAGGTGCCCATAGCCAAATCTCGAGATTTGGCTATGGGCACCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025536
VALIDATED
COMMD5 MISSION shRNA Lentiviral Transduction Particles
COMM domain containing 5
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025536.1-463s1c1
Sequence:CCGGCCAAGATATGATTGGAGATCTCTCGAGAGATCTCCAATCATATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025536.1-243s1c1
Sequence:CCGGGCACCTTCAGAAAGTTGTTGACTCGAGTCAACAACTTTCTGAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025536.1-628s1c1
Sequence:CCGGGAGTGTTCTCATGCAGCTGAACTCGAGTTCAGCTGCATGAGAACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251045    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025536.2-824s21c1
Sequence:CCGGCGCACTGGTGATGAGGATGTACTCGAGTACATCCTCATCACCAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025536.2-133s21c1
Sequence:CCGGTACTTACACCATCCAACTGACCTCGAGGTCAGTTGGATGGTGTAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025536.2-749s21c1
Sequence:CCGGAGAGAAAGTGTGAGCGCAAACCTCGAGGTTTGCGCTCACACTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025536.2-674s21c1
Sequence:CCGGTCGAGGTGCCCATAGCCAAATCTCGAGATTTGGCTATGGGCACCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014066
COMMD5 MISSION shRNA Bacterial Glycerol Stock
COMM domain containing 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118002    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014066.2-2762s1c1
Sequence:CCGGCCTCAGAATGTGACCTTGTTTCTCGAGAAACAAGGTCACATTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014066.2-371s1c1
Sequence:CCGGCACGTTCAGAAAGTTGCTGAACTCGAGTTCAGCAACTTTCTGAACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014066.2-711s1c1
Sequence:CCGGGATGTAGCAATCTCCACCAGTCTCGAGACTGGTGGAGATTGCTACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014066.2-365s1c1
Sequence:CCGGCAGGAGCACGTTCAGAAAGTTCTCGAGAACTTTCTGAACGTGCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014066.2-677s1c1
Sequence:CCGGGCTGCCGCATGTTGCTGACTTCTCGAGAAGTCAGCAACATGCGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439565    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014066.3-965s21c1
Sequence:CCGGCTCACTTGACCAGTCCCATTCCTCGAGGAATGGGACTGGTCAAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014066.3-808s21c1
Sequence:CCGGGAGCGTCCTGATGCAGCTGAACTCGAGTTCAGCTGCATCAGGACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430916    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014066.3-1078s21c1
Sequence:CCGGGTGAGTGTTTGAACGTAATTACTCGAGTAATTACGTTCAAACACTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014066
COMMD5 MISSION shRNA shRNA Plasmid DNA
COMM domain containing 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118002    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014066.2-2762s1c1
Sequence:CCGGCCTCAGAATGTGACCTTGTTTCTCGAGAAACAAGGTCACATTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014066.2-371s1c1
Sequence:CCGGCACGTTCAGAAAGTTGCTGAACTCGAGTTCAGCAACTTTCTGAACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014066.2-711s1c1
Sequence:CCGGGATGTAGCAATCTCCACCAGTCTCGAGACTGGTGGAGATTGCTACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014066.2-365s1c1
Sequence:CCGGCAGGAGCACGTTCAGAAAGTTCTCGAGAACTTTCTGAACGTGCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014066.2-677s1c1
Sequence:CCGGGCTGCCGCATGTTGCTGACTTCTCGAGAAGTCAGCAACATGCGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439565    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014066.3-965s21c1
Sequence:CCGGCTCACTTGACCAGTCCCATTCCTCGAGGAATGGGACTGGTCAAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014066.3-808s21c1
Sequence:CCGGGAGCGTCCTGATGCAGCTGAACTCGAGTTCAGCTGCATCAGGACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430916    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014066.3-1078s21c1
Sequence:CCGGGTGAGTGTTTGAACGTAATTACTCGAGTAATTACGTTCAAACACTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014066
COMMD5 MISSION shRNA Lentiviral Transduction Particles
COMM domain containing 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118002    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014066.2-2762s1c1
Sequence:CCGGCCTCAGAATGTGACCTTGTTTCTCGAGAAACAAGGTCACATTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014066.2-371s1c1
Sequence:CCGGCACGTTCAGAAAGTTGCTGAACTCGAGTTCAGCAACTTTCTGAACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014066.2-711s1c1
Sequence:CCGGGATGTAGCAATCTCCACCAGTCTCGAGACTGGTGGAGATTGCTACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014066.2-365s1c1
Sequence:CCGGCAGGAGCACGTTCAGAAAGTTCTCGAGAACTTTCTGAACGTGCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014066.2-677s1c1
Sequence:CCGGGCTGCCGCATGTTGCTGACTTCTCGAGAAGTCAGCAACATGCGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439565    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014066.3-965s21c1
Sequence:CCGGCTCACTTGACCAGTCCCATTCCTCGAGGAATGGGACTGGTCAAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014066.3-808s21c1
Sequence:CCGGGAGCGTCCTGATGCAGCTGAACTCGAGTTCAGCTGCATCAGGACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430916    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014066.3-1078s21c1
Sequence:CCGGGTGAGTGTTTGAACGTAATTACTCGAGTAATTACGTTCAAACACTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks