EMAIL THIS PAGE TO A FRIEND

COMMD6

COMM domain containing 6

Synonyms: Acrg
UniProtKB ID: Q7Z4G1, A6NF28, B7ZLN0, Q5TBK4
Gene ID:
Human(170622) Summary: COMMD6 belongs to a family of NF-kappa-B (see RELA; MIM 164014)-inhibiting proteins characterized by the presence of a COMM domain (see COMMD1; MIM 607238) (de Bie et al., 2006 [PubMed 16573520]
Mouse(66200) COMM domain containing 6
Rat(498559) COMM domain containing 6
chicken(769778) COMM domain containing 6
cow(616226) COMM domain containing 6
domestic cat(101082872) COMM domain containing 6
dog(476946) COMM domain containing 6
domestic guinea pig(100728464) COMM domain containing 6
naked mole-rat(101719348) COMM domain containing 6
sheep(101102498) COMM domain containing 6
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033132 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033132 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033132 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_203495 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_203495 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_203495 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_203495 Rosetta Predictions human pricing
NM_203497 Rosetta Predictions human pricing
NM_001109105 Rosetta Predictions rat pricing
NM_001033132 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203495 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113177 predicted 384
2 SASI_Hs02_00373421 predicted 721
3 SASI_Hs02_00373422 predicted 720
4 SASI_Hs01_00113182 predicted 70
5 SASI_Hs02_00373423 predicted 304
6 SASI_Hs01_00113183 predicted 196
7 SASI_Hs02_00373424 predicted 754
8 SASI_Hs01_00113186 predicted 331
9 SASI_Hs02_00373425 predicted 798
10 SASI_Hs02_00373426 predicted 149
11 SASI_Hs01_00113178 predicted 76
12 SASI_Hs01_00113179 predicted 133
13 SASI_Hs01_00113180 predicted 113
14 SASI_Hs01_00113181 predicted 116
15 SASI_Hs01_00113184 predicted 366
16 SASI_Hs01_00113185 predicted 286
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203497 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373427 predicted 418
2 SASI_Hs02_00373428 predicted 291
3 SASI_Hs02_00373429 predicted 762
4 SASI_Hs02_00373430 predicted 761
5 SASI_Hs02_00373431 predicted 77
6 SASI_Hs02_00373432 predicted 351
7 SASI_Hs02_00373433 predicted 196
8 SASI_Hs02_00373434 predicted 790
9 SASI_Hs02_00373435 predicted 367
10 SASI_Hs02_00373436 predicted 840
11 SASI_Hs01_00245662 predicted 219
12 SASI_Hs01_00245663 predicted 218
13 SASI_Hs01_00245664 predicted 214
14 SASI_Hs01_00245665 predicted 230
15 SASI_Hs01_00245666 predicted 206
16 SASI_Hs01_00245667 predicted 213
17 SASI_Hs01_00245668 predicted 219
18 SASI_Hs01_00245669 predicted 220
19 SASI_Hs01_00245670 predicted 229
20 SASI_Hs01_00245671 predicted 213
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109105 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245180 predicted 357
2 SASI_Rn02_00245181 predicted 469
3 SASI_Rn02_00245182 predicted 416
4 SASI_Rn02_00245183 predicted 538
5 SASI_Rn02_00245184 predicted 462
6 SASI_Rn02_00245185 predicted 541
7 SASI_Rn02_00245186 predicted 388
8 SASI_Rn02_00245187 predicted 469
9 SASI_Rn02_00245188 predicted 449
10 SASI_Rn02_00245189 predicted 413
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033132 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134521 predicted 330
2 SASI_Mm01_00134523 predicted 330
3 SASI_Mm01_00134524 predicted 536
4 SASI_Mm02_00288206 predicted 266
5 SASI_Mm01_00134526 predicted 297
6 SASI_Mm02_00288207 predicted 251
7 SASI_Mm01_00134527 predicted 270
8 SASI_Mm02_00288208 predicted 240
9 SASI_Mm02_00288209 predicted 246
10 SASI_Mm01_00134529 predicted 605
11 SASI_Mm01_00134522 predicted 243
12 SASI_Mm01_00134525 predicted 254
13 SASI_Mm01_00134528 predicted 197
14 SASI_Mm01_00134530 predicted 608
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033132
VALIDATED
COMMD6 MISSION shRNA Bacterial Glycerol Stock
COMM domain containing 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033132.2-239s21c1
Sequence:CCGGCAAAGAAATTGCCGCTGTAATCTCGAGATTACAGCGGCAATTTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254990    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033132.2-506s21c1
Sequence:CCGGACGCCAACGCTATAGAATAAACTCGAGTTTATTCTATAGCGTTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033132.2-190s21c1
Sequence:CCGGAGTCCATCGAGATGACAATTCCTCGAGGAATTGTCATCTCGATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033132.2-120s21c1
Sequence:CCGGAGATCTCTCAAGTATCCTTACCTCGAGGTAAGGATACTTGAGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033132.2-59s21c1
Sequence:CCGGCACGGGCCAGCTTATAGATTTCTCGAGAAATCTATAAGCTGGCCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033132
VALIDATED
COMMD6 MISSION shRNA shRNA Plasmid DNA
COMM domain containing 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033132.2-239s21c1
Sequence:CCGGCAAAGAAATTGCCGCTGTAATCTCGAGATTACAGCGGCAATTTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254990    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033132.2-506s21c1
Sequence:CCGGACGCCAACGCTATAGAATAAACTCGAGTTTATTCTATAGCGTTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033132.2-190s21c1
Sequence:CCGGAGTCCATCGAGATGACAATTCCTCGAGGAATTGTCATCTCGATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033132.2-120s21c1
Sequence:CCGGAGATCTCTCAAGTATCCTTACCTCGAGGTAAGGATACTTGAGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033132.2-59s21c1
Sequence:CCGGCACGGGCCAGCTTATAGATTTCTCGAGAAATCTATAAGCTGGCCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033132
VALIDATED
COMMD6 MISSION shRNA Lentiviral Transduction Particles
COMM domain containing 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033132.2-239s21c1
Sequence:CCGGCAAAGAAATTGCCGCTGTAATCTCGAGATTACAGCGGCAATTTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254990    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033132.2-506s21c1
Sequence:CCGGACGCCAACGCTATAGAATAAACTCGAGTTTATTCTATAGCGTTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033132.2-190s21c1
Sequence:CCGGAGTCCATCGAGATGACAATTCCTCGAGGAATTGTCATCTCGATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033132.2-120s21c1
Sequence:CCGGAGATCTCTCAAGTATCCTTACCTCGAGGTAAGGATACTTGAGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033132.2-59s21c1
Sequence:CCGGCACGGGCCAGCTTATAGATTTCTCGAGAAATCTATAAGCTGGCCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203495
VALIDATED
COMMD6 MISSION shRNA Bacterial Glycerol Stock
COMM domain containing 6
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_203495.1-151s1c1
Sequence:CCGGGTATCCTTACGTTGCAGTGATCTCGAGATCACTGCAACGTAAGGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_203495.1-183s1c1
Sequence:CCGGCAGATCATTCAGGCCAAGTAACTCGAGTTACTTGGCCTGAATGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203495.1-254s1c1
Sequence:CCGGCAGTTCAAGGAAATTGCTGCACTCGAGTGCAGCAATTTCCTTGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_203495.1-138s1c1
Sequence:CCGGGCAGATCTCTTAAGTATCCTTCTCGAGAAGGATACTTAAGAGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_203495.1-218s1c1
Sequence:CCGGGAAATGACGATTCCACAGTTTCTCGAGAAACTGTGGAATCGTCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_203495.1-296s1c1
Sequence:CCGGCGGATTCTTTGGTTGATAAATCTCGAGATTTATCAACCAAAGAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203495
VALIDATED
COMMD6 MISSION shRNA shRNA Plasmid DNA
COMM domain containing 6
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_203495.1-151s1c1
Sequence:CCGGGTATCCTTACGTTGCAGTGATCTCGAGATCACTGCAACGTAAGGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_203495.1-183s1c1
Sequence:CCGGCAGATCATTCAGGCCAAGTAACTCGAGTTACTTGGCCTGAATGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203495.1-254s1c1
Sequence:CCGGCAGTTCAAGGAAATTGCTGCACTCGAGTGCAGCAATTTCCTTGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_203495.1-138s1c1
Sequence:CCGGGCAGATCTCTTAAGTATCCTTCTCGAGAAGGATACTTAAGAGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_203495.1-218s1c1
Sequence:CCGGGAAATGACGATTCCACAGTTTCTCGAGAAACTGTGGAATCGTCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_203495.1-296s1c1
Sequence:CCGGCGGATTCTTTGGTTGATAAATCTCGAGATTTATCAACCAAAGAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203495
VALIDATED
COMMD6 MISSION shRNA Lentiviral Transduction Particles
COMM domain containing 6
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_203495.1-151s1c1
Sequence:CCGGGTATCCTTACGTTGCAGTGATCTCGAGATCACTGCAACGTAAGGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_203495.1-183s1c1
Sequence:CCGGCAGATCATTCAGGCCAAGTAACTCGAGTTACTTGGCCTGAATGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203495.1-254s1c1
Sequence:CCGGCAGTTCAAGGAAATTGCTGCACTCGAGTGCAGCAATTTCCTTGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_203495.1-138s1c1
Sequence:CCGGGCAGATCTCTTAAGTATCCTTCTCGAGAAGGATACTTAAGAGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_203495.1-218s1c1
Sequence:CCGGGAAATGACGATTCCACAGTTTCTCGAGAAACTGTGGAATCGTCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_203495.1-296s1c1
Sequence:CCGGCGGATTCTTTGGTTGATAAATCTCGAGATTTATCAACCAAAGAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks