EMAIL THIS PAGE TO A FRIEND

COMMD7

COMM domain containing 7

Synonyms: C20orf92 dJ1085F17.3
UniProtKB ID: Q86VX2, A2BHJ2, B3KTZ2, Q5JYB0, Q96SI7, Q9BW53
Gene ID:
Mouse(99311) COMM domain containing 7
Rat(296285) COMM domain containing 7
sheep(101104771) COMM domain containing 7
naked mole-rat(101706475) COMM domain containing 7
domestic guinea pig(100732691) COMM domain containing 7
Zebrafish(445183) COMM domain containing 7
chicken(419286) COMM domain containing 7
dog(612903) COMM domain containing 7
cow(514295) COMM domain containing 7
domestic cat(101100711) COMM domain containing 7
81 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133850 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133850 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133850 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_053041 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_053041 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_053041 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU054651 MISSION® esiRNA esiRNA human COMMD7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099339 Rosetta Predictions human pricing
NM_053041 Rosetta Predictions human pricing
NM_001030029 Rosetta Predictions rat pricing
NM_133850 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099339 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320519 predicted 1108
2 SASI_Hs02_00320520 predicted 1400
3 SASI_Hs02_00320521 predicted 1517
4 SASI_Hs02_00320522 predicted 1012
5 SASI_Hs02_00320523 predicted 913
6 SASI_Hs02_00320524 predicted 1616
7 SASI_Hs02_00320525 predicted 1061
8 SASI_Hs02_00320526 predicted 1180
9 SASI_Hs02_00320527 predicted 994
10 SASI_Hs02_00320528 predicted 1390
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053041 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361860 predicted 1111
2 SASI_Hs01_00065042 predicted 1399
3 SASI_Hs02_00361861 predicted 1524
4 SASI_Hs02_00361862 predicted 1013
5 SASI_Hs01_00065043 predicted 920
6 SASI_Hs02_00361863 predicted 1620
7 SASI_Hs02_00361864 predicted 1060
8 SASI_Hs01_00065046 predicted 1190
9 SASI_Hs01_00065047 predicted 1002
10 SASI_Hs02_00361865 predicted 1398
11 SASI_Hs01_00065040 predicted 1189
12 SASI_Hs01_00065041 predicted 626
13 SASI_Hs01_00065044 predicted 946
14 SASI_Hs01_00065045 predicted 1105
15 SASI_Hs01_00065048 predicted 950
16 SASI_Hs01_00065049 predicted 573
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030029 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086295 predicted 518
2 SASI_Rn01_00086296 predicted 363
3 SASI_Rn01_00086297 predicted 541
4 SASI_Rn01_00086298 predicted 452
5 SASI_Rn01_00086299 predicted 460
6 SASI_Rn01_00086300 predicted 221
7 SASI_Rn01_00086301 predicted 401
8 SASI_Rn01_00086302 predicted 677
9 SASI_Rn01_00086303 predicted 429
10 SASI_Rn01_00086304 predicted 261
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133850 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338887 predicted 326
2 SASI_Mm02_00338888 predicted 1149
3 SASI_Mm02_00338889 predicted 325
4 SASI_Mm02_00338890 predicted 274
5 SASI_Mm02_00338891 predicted 1111
6 SASI_Mm02_00338892 predicted 980
7 SASI_Mm02_00338893 predicted 273
8 SASI_Mm02_00338894 predicted 412
9 SASI_Mm02_00338895 predicted 1158
10 SASI_Mm02_00338896 predicted 434
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133850
VALIDATED
COMMD7 MISSION shRNA Bacterial Glycerol Stock
COMM domain containing 7
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184807    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133850.1-620s1c1
Sequence:CCGGCCCGAAATCAAGAGGTTCGAACTCGAGTTCGAACCTCTTGATTTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133850.1-671s21c1
Sequence:CCGGGTGAGCCACTTTCTTGAATTGCTCGAGCAATTCAAGAAAGTGGCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133850.1-558s21c1
Sequence:CCGGCAGGGTTTCAACCTGGTTAAACTCGAGTTTAACCAGGTTGAAACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257619    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133850.1-1177s21c1
Sequence:CCGGGCGACAAAGCATTCGAATATACTCGAGTATATTCGAATGCTTTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133850.1-529s21c1
Sequence:CCGGCAGGTAAGTCTGTGGTCAGTGCTCGAGCACTGACCACAGACTTACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133850.1-621s21c1
Sequence:CCGGCCGAAATCAAGAGGTTCGAACCTCGAGGTTCGAACCTCTTGATTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133850
VALIDATED
COMMD7 MISSION shRNA shRNA Plasmid DNA
COMM domain containing 7
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184807    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133850.1-620s1c1
Sequence:CCGGCCCGAAATCAAGAGGTTCGAACTCGAGTTCGAACCTCTTGATTTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133850.1-671s21c1
Sequence:CCGGGTGAGCCACTTTCTTGAATTGCTCGAGCAATTCAAGAAAGTGGCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133850.1-558s21c1
Sequence:CCGGCAGGGTTTCAACCTGGTTAAACTCGAGTTTAACCAGGTTGAAACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257619    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133850.1-1177s21c1
Sequence:CCGGGCGACAAAGCATTCGAATATACTCGAGTATATTCGAATGCTTTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133850.1-529s21c1
Sequence:CCGGCAGGTAAGTCTGTGGTCAGTGCTCGAGCACTGACCACAGACTTACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133850.1-621s21c1
Sequence:CCGGCCGAAATCAAGAGGTTCGAACCTCGAGGTTCGAACCTCTTGATTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133850
VALIDATED
COMMD7 MISSION shRNA Lentiviral Transduction Particles
COMM domain containing 7
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184807    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133850.1-620s1c1
Sequence:CCGGCCCGAAATCAAGAGGTTCGAACTCGAGTTCGAACCTCTTGATTTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133850.1-671s21c1
Sequence:CCGGGTGAGCCACTTTCTTGAATTGCTCGAGCAATTCAAGAAAGTGGCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133850.1-558s21c1
Sequence:CCGGCAGGGTTTCAACCTGGTTAAACTCGAGTTTAACCAGGTTGAAACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257619    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133850.1-1177s21c1
Sequence:CCGGGCGACAAAGCATTCGAATATACTCGAGTATATTCGAATGCTTTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133850.1-529s21c1
Sequence:CCGGCAGGTAAGTCTGTGGTCAGTGCTCGAGCACTGACCACAGACTTACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133850.1-621s21c1
Sequence:CCGGCCGAAATCAAGAGGTTCGAACCTCGAGGTTCGAACCTCTTGATTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053041
VALIDATED
COMMD7 MISSION shRNA Bacterial Glycerol Stock
COMM domain containing 7
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_053041.1-754s1c1
Sequence:CCGGCAGAACCAGCATGGAGTGTTTCTCGAGAAACACTCCATGCTGGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122049    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_053041.1-1086s1c1
Sequence:CCGGCCCTTCAAAGTTCCAGAGTAACTCGAGTTACTCTGGAACTTTGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053041.1-414s1c1
Sequence:CCGGCAAATGGTGCTTTGAAGAAGACTCGAGTCTTCTTCAAAGCACCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_053041.1-485s1c1
Sequence:CCGGGAGGAGAAAGCCACTTACTTTCTCGAGAAAGTAAGTGGCTTTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139009    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053041.1-454s1c1
Sequence:CCGGCCAGGCGGATTTCATAACTCTCTCGAGAGAGTTATGAAATCCGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_053041.1-458s1c1
Sequence:CCGGGCGGATTTCATAACTCTGGGTCTCGAGACCCAGAGTTATGAAATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_053041.1-957s1c1
Sequence:CCGGGCCCAACACAATTACCCTGTACTCGAGTACAGGGTAATTGTGTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053041.1-621s1c1
Sequence:CCGGGCGAATTGGAGAAAGTGGGAACTCGAGTTCCCACTTTCTCCAATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_053041.1-577s1c1
Sequence:CCGGGCTCATAGATATGGAGTGGAACTCGAGTTCCACTCCATATCTATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_053041.1-661s1c1
Sequence:CCGGGTTGGTGGTTAAGAAAGGAAACTCGAGTTTCCTTTCTTAACCACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_053041.1-461s1c1
Sequence:CCGGGATTTCATAACTCTGGGTCTTCTCGAGAAGACCCAGAGTTATGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053041.2-837s21c1
Sequence:CCGGAGCCTCCTTCTGGTTCCAAATCTCGAGATTTGGAACCAGAAGGAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053041.2-1163s21c1
Sequence:CCGGCTACAGCTTCCTGCACGAGATCTCGAGATCTCGTGCAGGAAGCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420345    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053041.2-1699s21c1
Sequence:CCGGCATTGCCAATCAGTTCTTAATCTCGAGATTAAGAACTGATTGGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053041
VALIDATED
COMMD7 MISSION shRNA shRNA Plasmid DNA
COMM domain containing 7
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_053041.1-754s1c1
Sequence:CCGGCAGAACCAGCATGGAGTGTTTCTCGAGAAACACTCCATGCTGGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122049    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_053041.1-1086s1c1
Sequence:CCGGCCCTTCAAAGTTCCAGAGTAACTCGAGTTACTCTGGAACTTTGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053041.1-414s1c1
Sequence:CCGGCAAATGGTGCTTTGAAGAAGACTCGAGTCTTCTTCAAAGCACCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_053041.1-485s1c1
Sequence:CCGGGAGGAGAAAGCCACTTACTTTCTCGAGAAAGTAAGTGGCTTTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139009    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053041.1-454s1c1
Sequence:CCGGCCAGGCGGATTTCATAACTCTCTCGAGAGAGTTATGAAATCCGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_053041.1-458s1c1
Sequence:CCGGGCGGATTTCATAACTCTGGGTCTCGAGACCCAGAGTTATGAAATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_053041.1-957s1c1
Sequence:CCGGGCCCAACACAATTACCCTGTACTCGAGTACAGGGTAATTGTGTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053041.1-621s1c1
Sequence:CCGGGCGAATTGGAGAAAGTGGGAACTCGAGTTCCCACTTTCTCCAATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_053041.1-577s1c1
Sequence:CCGGGCTCATAGATATGGAGTGGAACTCGAGTTCCACTCCATATCTATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_053041.1-661s1c1
Sequence:CCGGGTTGGTGGTTAAGAAAGGAAACTCGAGTTTCCTTTCTTAACCACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_053041.1-461s1c1
Sequence:CCGGGATTTCATAACTCTGGGTCTTCTCGAGAAGACCCAGAGTTATGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053041.2-837s21c1
Sequence:CCGGAGCCTCCTTCTGGTTCCAAATCTCGAGATTTGGAACCAGAAGGAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053041.2-1163s21c1
Sequence:CCGGCTACAGCTTCCTGCACGAGATCTCGAGATCTCGTGCAGGAAGCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420345    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053041.2-1699s21c1
Sequence:CCGGCATTGCCAATCAGTTCTTAATCTCGAGATTAAGAACTGATTGGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053041
VALIDATED
COMMD7 MISSION shRNA Lentiviral Transduction Particles
COMM domain containing 7
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_053041.1-754s1c1
Sequence:CCGGCAGAACCAGCATGGAGTGTTTCTCGAGAAACACTCCATGCTGGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122049    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_053041.1-1086s1c1
Sequence:CCGGCCCTTCAAAGTTCCAGAGTAACTCGAGTTACTCTGGAACTTTGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053041.1-414s1c1
Sequence:CCGGCAAATGGTGCTTTGAAGAAGACTCGAGTCTTCTTCAAAGCACCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_053041.1-485s1c1
Sequence:CCGGGAGGAGAAAGCCACTTACTTTCTCGAGAAAGTAAGTGGCTTTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139009    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053041.1-454s1c1
Sequence:CCGGCCAGGCGGATTTCATAACTCTCTCGAGAGAGTTATGAAATCCGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_053041.1-458s1c1
Sequence:CCGGGCGGATTTCATAACTCTGGGTCTCGAGACCCAGAGTTATGAAATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_053041.1-957s1c1
Sequence:CCGGGCCCAACACAATTACCCTGTACTCGAGTACAGGGTAATTGTGTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053041.1-621s1c1
Sequence:CCGGGCGAATTGGAGAAAGTGGGAACTCGAGTTCCCACTTTCTCCAATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_053041.1-577s1c1
Sequence:CCGGGCTCATAGATATGGAGTGGAACTCGAGTTCCACTCCATATCTATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_053041.1-661s1c1
Sequence:CCGGGTTGGTGGTTAAGAAAGGAAACTCGAGTTTCCTTTCTTAACCACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_053041.1-461s1c1
Sequence:CCGGGATTTCATAACTCTGGGTCTTCTCGAGAAGACCCAGAGTTATGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053041.2-837s21c1
Sequence:CCGGAGCCTCCTTCTGGTTCCAAATCTCGAGATTTGGAACCAGAAGGAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053041.2-1163s21c1
Sequence:CCGGCTACAGCTTCCTGCACGAGATCTCGAGATCTCGTGCAGGAAGCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420345    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053041.2-1699s21c1
Sequence:CCGGCATTGCCAATCAGTTCTTAATCTCGAGATTAAGAACTGATTGGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks