EMAIL THIS PAGE TO A FRIEND

COMMD8

COMM domain containing 8

71 Gene Product Result for
UniProtKB ID: Q9NX08, Q8WUR4, Q9HC15
Gene ID:
Mouse(27784) COMM domain containing 8
Rat(289603) COMM domain containing 8
Zebrafish(777610) COMM domain containing 8
chicken(422769) COMM domain containing 8
domestic cat(101089859) COMM domain containing 8
cow(507292) COMM domain containing 8
dog(475138) COMM domain containing 8
domestic guinea pig(100721713) COMM domain containing 8
naked mole-rat(101717190) COMM domain containing 8
sheep(101112319) COMM domain containing 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA035887 Anti-COMMD8 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2106036 Anti-COMMD8 antibody produced in rabbit affinity isolated antibody horse, human, guinea pig, rabbit
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017845 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017845 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017845 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178599 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178599 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178599 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU131631 MISSION® esiRNA esiRNA human COMMD8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017845 Rosetta Predictions human pricing
NM_001106004 Rosetta Predictions rat pricing
NM_178599 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017845 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026334 predicted 632
2 SASI_Hs01_00026335 predicted 670
3 SASI_Hs01_00026336 predicted 224
4 SASI_Hs01_00026337 predicted 706
5 SASI_Hs01_00026339 predicted 528
6 SASI_Hs01_00026340 predicted 569
7 SASI_Hs01_00026341 predicted 410
8 SASI_Hs01_00026342 predicted 723
9 SASI_Hs01_00026343 predicted 470
10 SASI_Hs02_00350739 predicted 373
11 SASI_Hs01_00026338 predicted 740
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106004 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214682 predicted 852
2 SASI_Rn02_00214683 predicted 837
3 SASI_Rn02_00214684 predicted 533
4 SASI_Rn02_00214685 predicted 234
5 SASI_Rn02_00214686 predicted 819
6 SASI_Rn02_00214687 predicted 400
7 SASI_Rn02_00214688 predicted 320
8 SASI_Rn02_00214689 predicted 830
9 SASI_Rn02_00214690 predicted 802
10 SASI_Rn02_00214691 predicted 470
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178599 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348929 predicted 554
2 SASI_Mm02_00348930 predicted 735
3 SASI_Mm02_00348931 predicted 812
4 SASI_Mm02_00348932 predicted 602
5 SASI_Mm02_00348933 predicted 848
6 SASI_Mm02_00348934 predicted 398
7 SASI_Mm02_00348935 predicted 711
8 SASI_Mm02_00348936 predicted 412
9 SASI_Mm02_00348937 predicted 500
10 SASI_Mm02_00348938 predicted 195
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017845
VALIDATED
COMMD8 MISSION shRNA Bacterial Glycerol Stock
COMM domain containing 8
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017845.3-192s21c1
Sequence:CCGGTTCAAAGCCATAGTTGGTAAACTCGAGTTTACCAACTATGGCTTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017845.3-96s21c1
Sequence:CCGGGGCATTTGTGGTCGAGCTTATCTCGAGATAAGCTCGACCACAAATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017845.3-216s21c1
Sequence:CCGGTTACCTGATGAAGAGATATTTCTCGAGAAATATCTCTTCATCAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017845.3-557s21c1
Sequence:CCGGATAACTGGAAATGATGAATACCTCGAGGTATTCATCATTTCCAGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017845.3-518s21c1
Sequence:CCGGGTCCTTGGAAGCAGCGAATAACTCGAGTTATTCGCTGCTTCCAAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343307    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017845.3-613s21c1
Sequence:CCGGGCAGAGTGAATACTGCGTGTTCTCGAGAACACGCAGTATTCACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137729    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017845.2-617s1c1
Sequence:CCGGGCAGAGTGAATACTGCGTGTTCTCGAGAACACGCAGTATTCACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134372    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017845.2-1217s1c1
Sequence:CCGGGCTTCTATGTTTGGGAAACATCTCGAGATGTTTCCCAAACATAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133822    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017845.2-116s1c1
Sequence:CCGGCTTATCCTGTGTACCAAGATTCTCGAGAATCTTGGTACACAGGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017845.2-322s1c1
Sequence:CCGGGCTCTGTCAAGAGAAATAGTTCTCGAGAACTATTTCTCTTGACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017845.2-155s1c1
Sequence:CCGGCAGAAGAATGGATGCACGTTTCTCGAGAAACGTGCATCCATTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017845.2-112s1c1
Sequence:CCGGCGAGCTTATCCTGTGTACCAACTCGAGTTGGTACACAGGATAAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017845.2-319s1c1
Sequence:CCGGCAGGCTCTGTCAAGAGAAATACTCGAGTATTTCTCTTGACAGAGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017845.2-139s1c1
Sequence:CCGGCACACTGTTTGGGAATCAGAACTCGAGTTCTGATTCCCAAACAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017845
VALIDATED
COMMD8 MISSION shRNA shRNA Plasmid DNA
COMM domain containing 8
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017845.3-192s21c1
Sequence:CCGGTTCAAAGCCATAGTTGGTAAACTCGAGTTTACCAACTATGGCTTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017845.3-96s21c1
Sequence:CCGGGGCATTTGTGGTCGAGCTTATCTCGAGATAAGCTCGACCACAAATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017845.3-216s21c1
Sequence:CCGGTTACCTGATGAAGAGATATTTCTCGAGAAATATCTCTTCATCAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017845.3-557s21c1
Sequence:CCGGATAACTGGAAATGATGAATACCTCGAGGTATTCATCATTTCCAGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017845.3-518s21c1
Sequence:CCGGGTCCTTGGAAGCAGCGAATAACTCGAGTTATTCGCTGCTTCCAAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343307    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017845.3-613s21c1
Sequence:CCGGGCAGAGTGAATACTGCGTGTTCTCGAGAACACGCAGTATTCACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137729    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017845.2-617s1c1
Sequence:CCGGGCAGAGTGAATACTGCGTGTTCTCGAGAACACGCAGTATTCACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134372    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017845.2-1217s1c1
Sequence:CCGGGCTTCTATGTTTGGGAAACATCTCGAGATGTTTCCCAAACATAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133822    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017845.2-116s1c1
Sequence:CCGGCTTATCCTGTGTACCAAGATTCTCGAGAATCTTGGTACACAGGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017845.2-322s1c1
Sequence:CCGGGCTCTGTCAAGAGAAATAGTTCTCGAGAACTATTTCTCTTGACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017845.2-155s1c1
Sequence:CCGGCAGAAGAATGGATGCACGTTTCTCGAGAAACGTGCATCCATTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017845.2-112s1c1
Sequence:CCGGCGAGCTTATCCTGTGTACCAACTCGAGTTGGTACACAGGATAAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017845.2-319s1c1
Sequence:CCGGCAGGCTCTGTCAAGAGAAATACTCGAGTATTTCTCTTGACAGAGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017845.2-139s1c1
Sequence:CCGGCACACTGTTTGGGAATCAGAACTCGAGTTCTGATTCCCAAACAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017845
VALIDATED
COMMD8 MISSION shRNA Lentiviral Transduction Particles
COMM domain containing 8
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017845.3-192s21c1
Sequence:CCGGTTCAAAGCCATAGTTGGTAAACTCGAGTTTACCAACTATGGCTTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017845.3-96s21c1
Sequence:CCGGGGCATTTGTGGTCGAGCTTATCTCGAGATAAGCTCGACCACAAATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017845.3-216s21c1
Sequence:CCGGTTACCTGATGAAGAGATATTTCTCGAGAAATATCTCTTCATCAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017845.3-557s21c1
Sequence:CCGGATAACTGGAAATGATGAATACCTCGAGGTATTCATCATTTCCAGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017845.3-518s21c1
Sequence:CCGGGTCCTTGGAAGCAGCGAATAACTCGAGTTATTCGCTGCTTCCAAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343307    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017845.3-613s21c1
Sequence:CCGGGCAGAGTGAATACTGCGTGTTCTCGAGAACACGCAGTATTCACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137729    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017845.2-617s1c1
Sequence:CCGGGCAGAGTGAATACTGCGTGTTCTCGAGAACACGCAGTATTCACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134372    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017845.2-1217s1c1
Sequence:CCGGGCTTCTATGTTTGGGAAACATCTCGAGATGTTTCCCAAACATAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133822    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017845.2-116s1c1
Sequence:CCGGCTTATCCTGTGTACCAAGATTCTCGAGAATCTTGGTACACAGGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017845.2-322s1c1
Sequence:CCGGGCTCTGTCAAGAGAAATAGTTCTCGAGAACTATTTCTCTTGACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017845.2-155s1c1
Sequence:CCGGCAGAAGAATGGATGCACGTTTCTCGAGAAACGTGCATCCATTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017845.2-112s1c1
Sequence:CCGGCGAGCTTATCCTGTGTACCAACTCGAGTTGGTACACAGGATAAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017845.2-319s1c1
Sequence:CCGGCAGGCTCTGTCAAGAGAAATACTCGAGTATTTCTCTTGACAGAGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017845.2-139s1c1
Sequence:CCGGCACACTGTTTGGGAATCAGAACTCGAGTTCTGATTCCCAAACAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178599
VALIDATED
COMMD8 MISSION shRNA Bacterial Glycerol Stock
COMM domain containing 8
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217282    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178599.4-419s1c1
Sequence:CCGGCGCTTTCTAGTGACAAGATTGCTCGAGCAATCTTGTCACTAGAAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217712    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178599.4-195s1c1
Sequence:CCGGGCATGTTCTCGAAGATGTTACCTCGAGGTAACATCTTCGAGAACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178599.4-505s21c1
Sequence:CCGGTACACTGTTGAGATGAGTAAACTCGAGTTTACTCATCTCAACAGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178599.4-378s21c1
Sequence:CCGGTTGTGCGCAGCTGCAGGATTTCTCGAGAAATCCTGCAGCTGCGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178599.4-549s21c1
Sequence:CCGGCTCCTTGGAGGCCGCTAATAACTCGAGTTATTAGCGGCCTCCAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250805    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178599.4-1950s21c1
Sequence:CCGGCACACTATAATGTCCATATTTCTCGAGAAATATGGACATTATAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178599.4-195s21c1
Sequence:CCGGGCATGTTCTCGAAGATGTTACCTCGAGGTAACATCTTCGAGAACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191951    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178599.2-514s1c1
Sequence:CCGGGAGATGAGTAAAGAGGAGTTACTCGAGTAACTCCTCTTTACTCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190511    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178599.2-1635s1c1
Sequence:CCGGGCTGCGACATAGCAGTGATTACTCGAGTAATCACTGCTATGTCGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191014    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178599.2-2276s1c1
Sequence:CCGGCCAGCATCTTTCTTTGTTCTTCTCGAGAAGAACAAAGAAAGATGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178599
VALIDATED
COMMD8 MISSION shRNA shRNA Plasmid DNA
COMM domain containing 8
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217282    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178599.4-419s1c1
Sequence:CCGGCGCTTTCTAGTGACAAGATTGCTCGAGCAATCTTGTCACTAGAAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217712    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178599.4-195s1c1
Sequence:CCGGGCATGTTCTCGAAGATGTTACCTCGAGGTAACATCTTCGAGAACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178599.4-505s21c1
Sequence:CCGGTACACTGTTGAGATGAGTAAACTCGAGTTTACTCATCTCAACAGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178599.4-378s21c1
Sequence:CCGGTTGTGCGCAGCTGCAGGATTTCTCGAGAAATCCTGCAGCTGCGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178599.4-549s21c1
Sequence:CCGGCTCCTTGGAGGCCGCTAATAACTCGAGTTATTAGCGGCCTCCAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250805    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178599.4-1950s21c1
Sequence:CCGGCACACTATAATGTCCATATTTCTCGAGAAATATGGACATTATAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178599.4-195s21c1
Sequence:CCGGGCATGTTCTCGAAGATGTTACCTCGAGGTAACATCTTCGAGAACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191951    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178599.2-514s1c1
Sequence:CCGGGAGATGAGTAAAGAGGAGTTACTCGAGTAACTCCTCTTTACTCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190511    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178599.2-1635s1c1
Sequence:CCGGGCTGCGACATAGCAGTGATTACTCGAGTAATCACTGCTATGTCGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191014    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178599.2-2276s1c1
Sequence:CCGGCCAGCATCTTTCTTTGTTCTTCTCGAGAAGAACAAAGAAAGATGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178599
VALIDATED
COMMD8 MISSION shRNA Lentiviral Transduction Particles
COMM domain containing 8
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217282    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178599.4-419s1c1
Sequence:CCGGCGCTTTCTAGTGACAAGATTGCTCGAGCAATCTTGTCACTAGAAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217712    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178599.4-195s1c1
Sequence:CCGGGCATGTTCTCGAAGATGTTACCTCGAGGTAACATCTTCGAGAACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178599.4-505s21c1
Sequence:CCGGTACACTGTTGAGATGAGTAAACTCGAGTTTACTCATCTCAACAGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178599.4-378s21c1
Sequence:CCGGTTGTGCGCAGCTGCAGGATTTCTCGAGAAATCCTGCAGCTGCGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178599.4-549s21c1
Sequence:CCGGCTCCTTGGAGGCCGCTAATAACTCGAGTTATTAGCGGCCTCCAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250805    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178599.4-1950s21c1
Sequence:CCGGCACACTATAATGTCCATATTTCTCGAGAAATATGGACATTATAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178599.4-195s21c1
Sequence:CCGGGCATGTTCTCGAAGATGTTACCTCGAGGTAACATCTTCGAGAACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191951    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178599.2-514s1c1
Sequence:CCGGGAGATGAGTAAAGAGGAGTTACTCGAGTAACTCCTCTTTACTCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190511    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178599.2-1635s1c1
Sequence:CCGGGCTGCGACATAGCAGTGATTACTCGAGTAATCACTGCTATGTCGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191014    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178599.2-2276s1c1
Sequence:CCGGCCAGCATCTTTCTTTGTTCTTCTCGAGAAGAACAAAGAAAGATGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks