EMAIL THIS PAGE TO A FRIEND

COMMD9

COMM domain containing 9

65 Gene Product Result for
UniProtKB ID: Q9P000, E9PAN2, Q96FI2, Q9H0R0
Gene ID:
Mouse(76501) COMM domain containing 9
Rat(295956) COMM domain containing 9
sheep(101106458) COMM domain containing 9
naked mole-rat(101697495) COMM domain containing 9
domestic guinea pig(100725006) COMM domain containing 9
Zebrafish(562660) COMM domain containing 9
chicken(423161) COMM domain containing 9
cow(510280) COMM domain containing 9
domestic cat(101096012) COMM domain containing 9
dog(608575) COMM domain containing 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029635 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029635 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029635 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014186 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014186 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014186 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU033381 MISSION® esiRNA esiRNA human COMMD9 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001101653 Rosetta Predictions human pricing
NM_014186 Rosetta Predictions human pricing
NM_001033692 Rosetta Predictions rat pricing
NM_029635 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101653 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322869 predicted 542
2 SASI_Hs02_00322870 predicted 475
3 SASI_Hs02_00322871 predicted 749
4 SASI_Hs02_00322872 predicted 434
5 SASI_Hs02_00322873 predicted 630
6 SASI_Hs02_00322874 predicted 833
7 SASI_Hs02_00322875 predicted 369
8 SASI_Hs02_00322876 predicted 851
9 SASI_Hs02_00322877 predicted 862
10 SASI_Hs02_00322878 predicted 281
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014186 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345216 predicted 662
2 SASI_Hs02_00345217 predicted 607
3 SASI_Hs01_00124529 predicted 876
4 SASI_Hs01_00124530 predicted 558
5 SASI_Hs01_00124531 predicted 750
6 SASI_Hs01_00124532 predicted 963
7 SASI_Hs01_00124533 predicted 494
8 SASI_Hs01_00124534 predicted 978
9 SASI_Hs01_00124536 predicted 989
10 SASI_Hs02_00345218 predicted 414
11 SASI_Hs01_00124527 predicted 316
12 SASI_Hs01_00124528 predicted 320
13 SASI_Hs01_00124535 predicted 263
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033692 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107675 predicted 902
2 SASI_Rn01_00107676 predicted 936
3 SASI_Rn01_00107677 predicted 867
4 SASI_Rn01_00107678 predicted 826
5 SASI_Rn01_00107679 predicted 317
6 SASI_Rn01_00107680 predicted 578
7 SASI_Rn01_00107681 predicted 342
8 SASI_Rn01_00107682 predicted 232
9 SASI_Rn02_00203712 predicted 849
10 SASI_Rn01_00107683 predicted 309
11 SASI_Rn01_00107684 predicted 312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029635 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196767 predicted 904
2 SASI_Mm01_00196768 predicted 939
3 SASI_Mm01_00196769 predicted 557
4 SASI_Mm01_00196770 predicted 577
5 SASI_Mm01_00196771 predicted 408
6 SASI_Mm01_00196772 predicted 623
7 SASI_Mm01_00196773 predicted 234
8 SASI_Mm01_00196774 predicted 469
9 SASI_Mm01_00196775 predicted 463
10 SASI_Mm02_00335630 predicted 312
11 SASI_Mm01_00196776 predicted 900
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029635
VALIDATED
COMMD9 MISSION shRNA Bacterial Glycerol Stock
COMM domain containing 9
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000195985    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029635.1-459s1c1
Sequence:CCGGCAGATGAAGATCCAGGAGGATCTCGAGATCCTCCTGGATCTTCATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195758    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029635.1-581s1c1
Sequence:CCGGCCAGCTTTCTGCTGTAGCTAACTCGAGTTAGCTACAGCAGAAAGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184455    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029635.1-914s1c1
Sequence:CCGGGTGAGGTTACCTCCAGCATTACTCGAGTAATGCTGGAGGTAACCTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029635.1-94s1c1
Sequence:CCGGGCCAAGAAAGCTTCTCCAGTTCTCGAGAACTGGAGAAGCTTTCTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029635.1-350s1c1
Sequence:CCGGCCAAGCAAACCAGATCTCTCTCTCGAGAGAGAGATCTGGTTTGCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029635.1-104s1c1
Sequence:CCGGCTTCTCCAGTTCATGCCTTGACTCGAGTCAAGGCATGAACTGGAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029635.3-90s21c1
Sequence:CCGGGCCAAGAAAGCTTCTCCAGTTCTCGAGAACTGGAGAAGCTTTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029635.3-100s21c1
Sequence:CCGGCTTCTCCAGTTCATGCCTTGACTCGAGTCAAGGCATGAACTGGAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329424    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029635.3-910s21c1
Sequence:CCGGGTGAGGTTACCTCCAGCATTACTCGAGTAATGCTGGAGGTAACCTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029635.3-580s21c1
Sequence:CCGGGCTTTCTGCTGTAGCTAATAACTCGAGTTATTAGCTACAGCAGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029635.3-246s21c1
Sequence:CCGGAGGCGATTCTGGCTCTCTTTCCTCGAGGAAAGAGAGCCAGAATCGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029635
VALIDATED
COMMD9 MISSION shRNA shRNA Plasmid DNA
COMM domain containing 9
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000195985    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029635.1-459s1c1
Sequence:CCGGCAGATGAAGATCCAGGAGGATCTCGAGATCCTCCTGGATCTTCATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195758    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029635.1-581s1c1
Sequence:CCGGCCAGCTTTCTGCTGTAGCTAACTCGAGTTAGCTACAGCAGAAAGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184455    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029635.1-914s1c1
Sequence:CCGGGTGAGGTTACCTCCAGCATTACTCGAGTAATGCTGGAGGTAACCTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029635.1-94s1c1
Sequence:CCGGGCCAAGAAAGCTTCTCCAGTTCTCGAGAACTGGAGAAGCTTTCTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029635.1-350s1c1
Sequence:CCGGCCAAGCAAACCAGATCTCTCTCTCGAGAGAGAGATCTGGTTTGCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029635.1-104s1c1
Sequence:CCGGCTTCTCCAGTTCATGCCTTGACTCGAGTCAAGGCATGAACTGGAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029635.3-90s21c1
Sequence:CCGGGCCAAGAAAGCTTCTCCAGTTCTCGAGAACTGGAGAAGCTTTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029635.3-100s21c1
Sequence:CCGGCTTCTCCAGTTCATGCCTTGACTCGAGTCAAGGCATGAACTGGAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329424    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029635.3-910s21c1
Sequence:CCGGGTGAGGTTACCTCCAGCATTACTCGAGTAATGCTGGAGGTAACCTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029635.3-580s21c1
Sequence:CCGGGCTTTCTGCTGTAGCTAATAACTCGAGTTATTAGCTACAGCAGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029635.3-246s21c1
Sequence:CCGGAGGCGATTCTGGCTCTCTTTCCTCGAGGAAAGAGAGCCAGAATCGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029635
VALIDATED
COMMD9 MISSION shRNA Lentiviral Transduction Particles
COMM domain containing 9
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000195985    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029635.1-459s1c1
Sequence:CCGGCAGATGAAGATCCAGGAGGATCTCGAGATCCTCCTGGATCTTCATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195758    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029635.1-581s1c1
Sequence:CCGGCCAGCTTTCTGCTGTAGCTAACTCGAGTTAGCTACAGCAGAAAGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184455    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029635.1-914s1c1
Sequence:CCGGGTGAGGTTACCTCCAGCATTACTCGAGTAATGCTGGAGGTAACCTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029635.1-94s1c1
Sequence:CCGGGCCAAGAAAGCTTCTCCAGTTCTCGAGAACTGGAGAAGCTTTCTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029635.1-350s1c1
Sequence:CCGGCCAAGCAAACCAGATCTCTCTCTCGAGAGAGAGATCTGGTTTGCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029635.1-104s1c1
Sequence:CCGGCTTCTCCAGTTCATGCCTTGACTCGAGTCAAGGCATGAACTGGAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029635.3-90s21c1
Sequence:CCGGGCCAAGAAAGCTTCTCCAGTTCTCGAGAACTGGAGAAGCTTTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029635.3-100s21c1
Sequence:CCGGCTTCTCCAGTTCATGCCTTGACTCGAGTCAAGGCATGAACTGGAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329424    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029635.3-910s21c1
Sequence:CCGGGTGAGGTTACCTCCAGCATTACTCGAGTAATGCTGGAGGTAACCTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029635.3-580s21c1
Sequence:CCGGGCTTTCTGCTGTAGCTAATAACTCGAGTTATTAGCTACAGCAGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029635.3-246s21c1
Sequence:CCGGAGGCGATTCTGGCTCTCTTTCCTCGAGGAAAGAGAGCCAGAATCGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014186
VALIDATED
COMMD9 MISSION shRNA Bacterial Glycerol Stock
COMM domain containing 9
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014186.1-397s1c1
Sequence:CCGGGACTGGAGAGTGGATATCAAACTCGAGTTTGATATCCACTCTCCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168849    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014186.1-1165s1c1
Sequence:CCGGGAAGTCTGAAATGGGTGCTAACTCGAGTTAGCACCCATTTCAGACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172295    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014186.1-357s1c1
Sequence:CCGGCCAGGCAAATCAGATCTCTCTCTCGAGAGAGAGATCTGATTTGCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168557    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014186.1-858s1c1
Sequence:CCGGGCTCCTGAGTGCAACTTAATTCTCGAGAATTAAGTTGCACTCAGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014186.1-75s1c1
Sequence:CCGGCTCGAAAGATGTTGTCAGACACTCGAGTGTCTGACAACATCTTTCGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167758    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014186.1-962s1c1
Sequence:CCGGGCCTATCCAATAAGTAAGTTTCTCGAGAAACTTACTTATTGGATAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014186
VALIDATED
COMMD9 MISSION shRNA shRNA Plasmid DNA
COMM domain containing 9
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014186.1-397s1c1
Sequence:CCGGGACTGGAGAGTGGATATCAAACTCGAGTTTGATATCCACTCTCCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168849    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014186.1-1165s1c1
Sequence:CCGGGAAGTCTGAAATGGGTGCTAACTCGAGTTAGCACCCATTTCAGACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172295    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014186.1-357s1c1
Sequence:CCGGCCAGGCAAATCAGATCTCTCTCTCGAGAGAGAGATCTGATTTGCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168557    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014186.1-858s1c1
Sequence:CCGGGCTCCTGAGTGCAACTTAATTCTCGAGAATTAAGTTGCACTCAGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014186.1-75s1c1
Sequence:CCGGCTCGAAAGATGTTGTCAGACACTCGAGTGTCTGACAACATCTTTCGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167758    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014186.1-962s1c1
Sequence:CCGGGCCTATCCAATAAGTAAGTTTCTCGAGAAACTTACTTATTGGATAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014186
VALIDATED
COMMD9 MISSION shRNA Lentiviral Transduction Particles
COMM domain containing 9
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014186.1-397s1c1
Sequence:CCGGGACTGGAGAGTGGATATCAAACTCGAGTTTGATATCCACTCTCCAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168849    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014186.1-1165s1c1
Sequence:CCGGGAAGTCTGAAATGGGTGCTAACTCGAGTTAGCACCCATTTCAGACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172295    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014186.1-357s1c1
Sequence:CCGGCCAGGCAAATCAGATCTCTCTCTCGAGAGAGAGATCTGATTTGCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168557    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014186.1-858s1c1
Sequence:CCGGGCTCCTGAGTGCAACTTAATTCTCGAGAATTAAGTTGCACTCAGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014186.1-75s1c1
Sequence:CCGGCTCGAAAGATGTTGTCAGACACTCGAGTGTCTGACAACATCTTTCGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167758    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014186.1-962s1c1
Sequence:CCGGGCCTATCCAATAAGTAAGTTTCTCGAGAAACTTACTTATTGGATAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)