EMAIL THIS PAGE TO A FRIEND

COMP

cartilage oligomeric matrix protein

53 Gene Product Result for
Synonyms: EDM1 EPD1 MED PSACH THBS5
UniProtKB ID: P49747, O14592, Q16388, Q16389, Q2NL86, Q8N4T2
Gene ID:
Human(1311) Summary: The protein encoded by this gene is a noncollagenous extracellular matrix (ECM) protein. It consists of five identical glycoprotein subunits, each with EGF-like and calcium-binding (thrombospondin-like) domains. Oligomerization results from formation of a five-stranded coiled coil and disulfides. Binding to other ECM proteins such as collagen appears to depend on divalent cations. Mutations can cause the osteochondrodysplasias pseudochondroplasia (PSACH) and multiple epiphyseal dysplasia (MED). [provided by RefSeq, Jul 2008]
Mouse(12845) cartilage oligomeric matrix protein
Rat(25304) cartilage oligomeric matrix protein
Zebrafish(562189) cartilage oligomeric matrix protein
cow(281088) cartilage oligomeric matrix protein
cow(100309120) Muscle compression
cow(100307974) Muscle compression
Horse(100033911) cartilage oligomeric matrix protein
domestic cat(101088820) cartilage oligomeric matrix protein
dog(476665) cartilage oligomeric matrix protein
chicken(420120) cartilage oligomeric matrix protein
domestic guinea pig(100720040) cartilage oligomeric matrix protein
naked mole-rat(101703996) cartilage oligomeric matrix protein
sheep(101107864) cartilage oligomeric matrix protein
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301234 ANTI-COMP (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing
SAB1411896 ANTI-COMP antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4300735 Anti-COMP antibody produced in rabbit affinity isolated antibody human
western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0930 AQUA Peptide ELQETNAALQDV[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000095 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000095 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000095 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016685 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016685 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016685 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU144221 MISSION® esiRNA esiRNA human COMP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000095 Rosetta Predictions human pricing
NM_012834 Rosetta Predictions rat pricing
NM_016685 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000095 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061392 predicted 1299
2 SASI_Hs02_00301860 predicted 1751
3 SASI_Hs01_00061393 predicted 2043
4 SASI_Hs01_00061394 predicted 2125
5 SASI_Hs01_00061395 predicted 1815
6 SASI_Hs01_00061396 predicted 1780
7 SASI_Hs01_00061397 predicted 1186
8 SASI_Hs02_00301861 predicted 1930
9 SASI_Hs01_00061398 predicted 1283
10 SASI_Hs01_00061399 predicted 1347
11 SASI_Hs01_00061400 predicted 2066
12 SASI_Hs01_00061401 predicted 1566
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012834 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081875 predicted 1718
2 SASI_Rn01_00081876 predicted 1112
3 SASI_Rn01_00081877 predicted 524
4 SASI_Rn01_00081878 predicted 1170
5 SASI_Rn01_00081880 predicted 1264
6 SASI_Rn01_00081881 predicted 2095
7 SASI_Rn01_00081882 predicted 1511
8 SASI_Rn01_00081883 predicted 1521
9 SASI_Rn01_00081884 predicted 2003
10 SASI_Rn02_00260302 predicted 1943
11 SASI_Rn01_00081879 predicted 714
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016685 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323338 predicted 1801
2 SASI_Mm01_00059956 predicted 1283
3 SASI_Mm01_00059957 predicted 1182
4 SASI_Mm01_00059958 predicted 548
5 SASI_Mm01_00059959 predicted 2111
6 SASI_Mm02_00323339 predicted 1835
7 SASI_Mm01_00059960 predicted 2106
8 SASI_Mm01_00059961 predicted 1077
9 SASI_Mm01_00059962 predicted 1077
10 SASI_Mm01_00059963 predicted 454
11 SASI_Mm01_00059964 predicted 1130
12 SASI_Mm01_00059965 predicted 1054
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000095
COMP MISSION shRNA Bacterial Glycerol Stock
cartilage oligomeric matrix protein
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056073    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000095.2-2319s1c1
Sequence:CCGGGTGAGGACCCGCCGGATGACACTCGAGTGTCATCCGGCGGGTCCTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000095.2-1749s1c1
Sequence:CCGGTGTGGGTTACACTGCCTTCAACTCGAGTTGAAGGCAGTGTAACCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000095.2-1094s1c1
Sequence:CCGGCCCAGAAGAACGACGACCAAACTCGAGTTTGGTCGTCGTTCTTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000095.2-1890s1c1
Sequence:CCGGGCAAACGTATTGGCAGGCGAACTCGAGTTCGCCTGCCAATACGTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000095.2-1318s1c1
Sequence:CCGGGATGCTTGTGACAGCGATCAACTCGAGTTGATCGCTGTCACAAGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000095
COMP MISSION shRNA shRNA Plasmid DNA
cartilage oligomeric matrix protein
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056073    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000095.2-2319s1c1
Sequence:CCGGGTGAGGACCCGCCGGATGACACTCGAGTGTCATCCGGCGGGTCCTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000095.2-1749s1c1
Sequence:CCGGTGTGGGTTACACTGCCTTCAACTCGAGTTGAAGGCAGTGTAACCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000095.2-1094s1c1
Sequence:CCGGCCCAGAAGAACGACGACCAAACTCGAGTTTGGTCGTCGTTCTTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000095.2-1890s1c1
Sequence:CCGGGCAAACGTATTGGCAGGCGAACTCGAGTTCGCCTGCCAATACGTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000095.2-1318s1c1
Sequence:CCGGGATGCTTGTGACAGCGATCAACTCGAGTTGATCGCTGTCACAAGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000095
COMP MISSION shRNA Lentiviral Transduction Particles
cartilage oligomeric matrix protein
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056073    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000095.2-2319s1c1
Sequence:CCGGGTGAGGACCCGCCGGATGACACTCGAGTGTCATCCGGCGGGTCCTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000095.2-1749s1c1
Sequence:CCGGTGTGGGTTACACTGCCTTCAACTCGAGTTGAAGGCAGTGTAACCCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000095.2-1094s1c1
Sequence:CCGGCCCAGAAGAACGACGACCAAACTCGAGTTTGGTCGTCGTTCTTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000095.2-1890s1c1
Sequence:CCGGGCAAACGTATTGGCAGGCGAACTCGAGTTCGCCTGCCAATACGTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000095.2-1318s1c1
Sequence:CCGGGATGCTTGTGACAGCGATCAACTCGAGTTGATCGCTGTCACAAGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016685
COMP MISSION shRNA Bacterial Glycerol Stock
cartilage oligomeric matrix protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016685.1-530s1c1
Sequence:CCGGCAAACAAGTTTGCACGGATATCTCGAGATATCCGTGCAAACTTGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016685.1-1062s1c1
Sequence:CCGGCGGTCCAAGAAGAATGACGATCTCGAGATCGTCATTCTTCTTGGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016685.1-1754s1c1
Sequence:CCGGCGAGGGCACATTCCATGTAAACTCGAGTTTACATGGAATGTGCCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016685.1-2195s1c1
Sequence:CCGGAGAGAACATCATTTGGGCTAACTCGAGTTAGCCCAAATGATGTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016685.1-117s1c1
Sequence:CCGGCGAGAACTTCAGGAGACTAATCTCGAGATTAGTCTCCTGAAGTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016685
COMP MISSION shRNA shRNA Plasmid DNA
cartilage oligomeric matrix protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016685.1-530s1c1
Sequence:CCGGCAAACAAGTTTGCACGGATATCTCGAGATATCCGTGCAAACTTGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016685.1-1062s1c1
Sequence:CCGGCGGTCCAAGAAGAATGACGATCTCGAGATCGTCATTCTTCTTGGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016685.1-1754s1c1
Sequence:CCGGCGAGGGCACATTCCATGTAAACTCGAGTTTACATGGAATGTGCCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016685.1-2195s1c1
Sequence:CCGGAGAGAACATCATTTGGGCTAACTCGAGTTAGCCCAAATGATGTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016685.1-117s1c1
Sequence:CCGGCGAGAACTTCAGGAGACTAATCTCGAGATTAGTCTCCTGAAGTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016685
COMP MISSION shRNA Lentiviral Transduction Particles
cartilage oligomeric matrix protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016685.1-530s1c1
Sequence:CCGGCAAACAAGTTTGCACGGATATCTCGAGATATCCGTGCAAACTTGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016685.1-1062s1c1
Sequence:CCGGCGGTCCAAGAAGAATGACGATCTCGAGATCGTCATTCTTCTTGGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016685.1-1754s1c1
Sequence:CCGGCGAGGGCACATTCCATGTAAACTCGAGTTTACATGGAATGTGCCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016685.1-2195s1c1
Sequence:CCGGAGAGAACATCATTTGGGCTAACTCGAGTTAGCCCAAATGATGTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016685.1-117s1c1
Sequence:CCGGCGAGAACTTCAGGAGACTAATCTCGAGATTAGTCTCCTGAAGTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)