EMAIL THIS PAGE TO A FRIEND

COMT

catechol-O-methyltransferase

95 Gene Product Result for
UniProtKB ID: P21964, A8MPV9, Q6IB07, Q6ICE6
Gene ID:
Human(1312) Summary: Catechol-O-methyltransferase catalyzes the transfer of a methyl group from S-adenosylmethionine to catecholamines, including the neurotransmitters dopamine, epinephrine, and norepinephrine. This O-methylation results in one of the major degradative pathways of the catecholamine transmitters. In addition to its role in the metabolism of endogenous substances, COMT is important in the metabolism of catechol drugs used in the treatment of hypertension, asthma, and Parkinson disease. COMT is found in two forms in tissues, a soluble form (S-COMT) and a membrane-bound form (MB-COMT). The differences between S-COMT and MB-COMT reside within the N-termini. Several transcript variants are formed through the use of alternative translation initiation sites and promoters. [provided by RefSeq, Sep 2008]
Mouse(12846) catechol-O-methyltransferase
Rat(24267) catechol-O-methyltransferase
fruit fly(47091) comatose
chicken(416783) catechol-O-methyltransferase
domestic cat(101097022) catechol-O-methyltransferase
cow(618278) catechol-O-methyltransferase
Horse(100146509) catechol-O-methyltransferase
dog(445450) catechol-O-methyltransferase
naked mole-rat(101717730) catechol-O-methyltransferase
domestic guinea pig(100730509) catechol-O-methyltransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1105080 Anti-COMT (11-22) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB1105081 Anti-COMT (36-49) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB2500261 Anti-COMT (Internal) antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
C6995 Anti-COMT (N-terminal) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, rat, mouse
western blot pricing
SAB1405643 Anti-COMT antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA001169 Anti-COMT antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, human
immunohistochemistry, western blot pricing
C6870 Anti-COMT antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse, rat
immunoprecipitation, western blot pricing
SAB2104916 Anti-COMT antibody produced in rabbit affinity isolated antibody guinea pig, human, horse, rabbit
western blot pricing
SAB4500401 Anti-COMT antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
WH0001312M1 Monoclonal Anti-COMT antibody produced in mouse clone 1G4-1A1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
D131 3,5-Dinitrocatechol solid human pricing
R108 Ro 41-0960 solid human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000754 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000754 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000754 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007744 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007744 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007744 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000754 Rosetta Predictions human pricing
NM_007310 Rosetta Predictions human pricing
NM_012531 Rosetta Predictions rat pricing
NM_001111062 Rosetta Predictions mouse pricing
NM_001111063 Rosetta Predictions mouse pricing
NM_007744 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000754 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088008 predicted 789
2 SASI_Hs01_00088009 predicted 603
3 SASI_Hs01_00088010 predicted 490
4 SASI_Hs01_00088011 predicted 651
5 SASI_Hs01_00088012 predicted 648
6 SASI_Hs01_00088013 predicted 547
7 SASI_Hs01_00088014 predicted 485
8 SASI_Hs01_00088015 predicted 721
9 SASI_Hs02_00303184 predicted 674
10 SASI_Hs01_00088016 predicted 479
11 SASI_Hs01_00088017 predicted 754
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007310 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216453 predicted 564
2 SASI_Hs01_00216454 predicted 377
3 SASI_Hs01_00216455 predicted 264
4 SASI_Hs01_00216456 predicted 429
5 SASI_Hs01_00216457 predicted 427
6 SASI_Hs01_00216458 predicted 320
7 SASI_Hs01_00216459 predicted 260
8 SASI_Hs01_00216460 predicted 494
9 SASI_Hs02_00343380 predicted 452
10 SASI_Hs01_00216461 predicted 253
11 SASI_Hs01_00216462 predicted 535
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012531 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075856 predicted 871
2 SASI_Rn02_00259606 predicted 930
3 SASI_Rn01_00075857 predicted 691
4 SASI_Rn02_00259607 predicted 289
5 SASI_Rn01_00075858 predicted 1143
6 SASI_Rn02_00259608 predicted 429
7 SASI_Rn01_00075859 predicted 1337
8 SASI_Rn01_00075860 predicted 1138
9 SASI_Rn01_00075861 predicted 726
10 SASI_Rn01_00075862 predicted 943
11 SASI_Rn01_00075855 predicted 1270
12 SASI_Rn01_00075863 predicted 1222
13 SASI_Rn01_00075864 predicted 403
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111062 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306275 predicted 1248
2 SASI_Mm02_00306276 predicted 928
3 SASI_Mm02_00306277 predicted 938
4 SASI_Mm02_00306278 predicted 930
5 SASI_Mm02_00306279 predicted 957
6 SASI_Mm02_00306280 predicted 1112
7 SASI_Mm02_00306281 predicted 982
8 SASI_Mm02_00306282 predicted 682
9 SASI_Mm02_00306283 predicted 626
10 SASI_Mm02_00306284 predicted 1105
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111063 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306285 predicted 1054
2 SASI_Mm02_00306286 predicted 742
3 SASI_Mm02_00306287 predicted 748
4 SASI_Mm02_00306288 predicted 739
5 SASI_Mm02_00306289 predicted 762
6 SASI_Mm02_00306290 predicted 922
7 SASI_Mm02_00306291 predicted 791
8 SASI_Mm02_00306292 predicted 491
9 SASI_Mm02_00306293 predicted 441
10 SASI_Mm02_00306294 predicted 919
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007744 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312343 predicted 1188
2 SASI_Mm01_00097784 predicted 880
3 SASI_Mm01_00097785 predicted 882
4 SASI_Mm01_00097786 predicted 865
5 SASI_Mm02_00312344 predicted 900
6 SASI_Mm02_00312345 predicted 1058
7 SASI_Mm01_00097787 predicted 921
8 SASI_Mm01_00097788 predicted 625
9 SASI_Mm01_00097789 predicted 569
10 SASI_Mm02_00312346 predicted 1046
11 SASI_Mm01_00097782 predicted 326
12 SASI_Mm01_00097783 predicted 958
13 SASI_Mm01_00097790 predicted 621
14 SASI_Mm01_00097791 predicted 822
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000754
VALIDATED
COMT MISSION shRNA Bacterial Glycerol Stock
catechol-O-methyltransferase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000754.2-298s1c1
Sequence:CCGGCCTGTGCCTTATCGGCTGGAACTCGAGTTCCAGCCGATAAGGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000754.2-727s1c1
Sequence:CCGGGCTGAAGAAGAAGTATGATGTCTCGAGACATCATACTTCTTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000754.2-913s1c1
Sequence:CCGGCTGCTTTGAGTGCACACACTACTCGAGTAGTGTGTGCACTCAAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000754.2-931s1c1
Sequence:CCGGCTACCAATCGTTCCTGGAATACTCGAGTATTCCAGGAACGATTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000754.2-801s1c1
Sequence:CCGGACACGCTTCTCTTGGAGGAATCTCGAGATTCCTCCAAGAGAAGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000754.3-518s21c1
Sequence:CCGGTGAACGTGGGCGACAAGAAAGCTCGAGCTTTCTTGTCGCCCACGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000754.3-978s21c1
Sequence:CCGGCTACCAATCGTTCCTGGAATACTCGAGTATTCCAGGAACGATTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000754.3-774s21c1
Sequence:CCGGGCTGAAGAAGAAGTATGATGTCTCGAGACATCATACTTCTTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000754.3-960s21c1
Sequence:CCGGCTGCTTTGAGTGCACACACTACTCGAGTAGTGTGTGCACTCAAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294178    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000754.3-1269s21c1
Sequence:CCGGCTAACACTGGCTAGCTATATTCTCGAGAATATAGCTAGCCAGTGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000754
VALIDATED
COMT MISSION shRNA shRNA Plasmid DNA
catechol-O-methyltransferase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000754.2-298s1c1
Sequence:CCGGCCTGTGCCTTATCGGCTGGAACTCGAGTTCCAGCCGATAAGGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000754.2-727s1c1
Sequence:CCGGGCTGAAGAAGAAGTATGATGTCTCGAGACATCATACTTCTTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000754.2-913s1c1
Sequence:CCGGCTGCTTTGAGTGCACACACTACTCGAGTAGTGTGTGCACTCAAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000754.2-931s1c1
Sequence:CCGGCTACCAATCGTTCCTGGAATACTCGAGTATTCCAGGAACGATTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000754.2-801s1c1
Sequence:CCGGACACGCTTCTCTTGGAGGAATCTCGAGATTCCTCCAAGAGAAGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000754.3-518s21c1
Sequence:CCGGTGAACGTGGGCGACAAGAAAGCTCGAGCTTTCTTGTCGCCCACGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000754.3-978s21c1
Sequence:CCGGCTACCAATCGTTCCTGGAATACTCGAGTATTCCAGGAACGATTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000754.3-774s21c1
Sequence:CCGGGCTGAAGAAGAAGTATGATGTCTCGAGACATCATACTTCTTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000754.3-960s21c1
Sequence:CCGGCTGCTTTGAGTGCACACACTACTCGAGTAGTGTGTGCACTCAAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294178    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000754.3-1269s21c1
Sequence:CCGGCTAACACTGGCTAGCTATATTCTCGAGAATATAGCTAGCCAGTGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000754
VALIDATED
COMT MISSION shRNA Lentiviral Transduction Particles
catechol-O-methyltransferase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000754.2-298s1c1
Sequence:CCGGCCTGTGCCTTATCGGCTGGAACTCGAGTTCCAGCCGATAAGGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000754.2-727s1c1
Sequence:CCGGGCTGAAGAAGAAGTATGATGTCTCGAGACATCATACTTCTTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000754.2-913s1c1
Sequence:CCGGCTGCTTTGAGTGCACACACTACTCGAGTAGTGTGTGCACTCAAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000754.2-931s1c1
Sequence:CCGGCTACCAATCGTTCCTGGAATACTCGAGTATTCCAGGAACGATTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000754.2-801s1c1
Sequence:CCGGACACGCTTCTCTTGGAGGAATCTCGAGATTCCTCCAAGAGAAGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000754.3-518s21c1
Sequence:CCGGTGAACGTGGGCGACAAGAAAGCTCGAGCTTTCTTGTCGCCCACGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000754.3-978s21c1
Sequence:CCGGCTACCAATCGTTCCTGGAATACTCGAGTATTCCAGGAACGATTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000754.3-774s21c1
Sequence:CCGGGCTGAAGAAGAAGTATGATGTCTCGAGACATCATACTTCTTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000754.3-960s21c1
Sequence:CCGGCTGCTTTGAGTGCACACACTACTCGAGTAGTGTGTGCACTCAAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294178    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000754.3-1269s21c1
Sequence:CCGGCTAACACTGGCTAGCTATATTCTCGAGAATATAGCTAGCCAGTGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007744
VALIDATED
COMT MISSION shRNA Bacterial Glycerol Stock
catechol-O-methyltransferase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097609    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007744.1-1070s1c1
Sequence:CCGGGATTGTCATACACTGGCACATCTCGAGATGTGCCAGTGTATGACAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007744.1-484s1c1
Sequence:CCGGGCTAGGAGCTTATTGTGGCTACTCGAGTAGCCACAATAAGCTCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007744.1-682s1c1
Sequence:CCGGCGATGTGGACACATTAGACATCTCGAGATGTCTAATGTGTCCACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007744.1-433s1c1
Sequence:CCGGCCAAATCATGGATGCAGTGATCTCGAGATCACTGCATCCATGATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007744.1-692s1c1
Sequence:CCGGACATTAGACATGGTCTTTCTTCTCGAGAAGAAAGACCATGTCTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007744.3-880s21c1
Sequence:CCGGCGATGTGGACACATTAGACATCTCGAGATGTCTAATGTGTCCACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007744.3-682s21c1
Sequence:CCGGGCTAGGAGCTTATTGTGGCTACTCGAGTAGCCACAATAAGCTCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007744.3-631s21c1
Sequence:CCGGCCAAATCATGGATGCAGTGATCTCGAGATCACTGCATCCATGATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326511    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007744.3-1268s21c1
Sequence:CCGGGATTGTCATACACTGGCACATCTCGAGATGTGCCAGTGTATGACAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007744
VALIDATED
COMT MISSION shRNA shRNA Plasmid DNA
catechol-O-methyltransferase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097609    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007744.1-1070s1c1
Sequence:CCGGGATTGTCATACACTGGCACATCTCGAGATGTGCCAGTGTATGACAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007744.1-484s1c1
Sequence:CCGGGCTAGGAGCTTATTGTGGCTACTCGAGTAGCCACAATAAGCTCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007744.1-682s1c1
Sequence:CCGGCGATGTGGACACATTAGACATCTCGAGATGTCTAATGTGTCCACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007744.1-433s1c1
Sequence:CCGGCCAAATCATGGATGCAGTGATCTCGAGATCACTGCATCCATGATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007744.1-692s1c1
Sequence:CCGGACATTAGACATGGTCTTTCTTCTCGAGAAGAAAGACCATGTCTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007744.3-880s21c1
Sequence:CCGGCGATGTGGACACATTAGACATCTCGAGATGTCTAATGTGTCCACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007744.3-682s21c1
Sequence:CCGGGCTAGGAGCTTATTGTGGCTACTCGAGTAGCCACAATAAGCTCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007744.3-631s21c1
Sequence:CCGGCCAAATCATGGATGCAGTGATCTCGAGATCACTGCATCCATGATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326511    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007744.3-1268s21c1
Sequence:CCGGGATTGTCATACACTGGCACATCTCGAGATGTGCCAGTGTATGACAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007744
VALIDATED
COMT MISSION shRNA Lentiviral Transduction Particles
catechol-O-methyltransferase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097609    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007744.1-1070s1c1
Sequence:CCGGGATTGTCATACACTGGCACATCTCGAGATGTGCCAGTGTATGACAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007744.1-484s1c1
Sequence:CCGGGCTAGGAGCTTATTGTGGCTACTCGAGTAGCCACAATAAGCTCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007744.1-682s1c1
Sequence:CCGGCGATGTGGACACATTAGACATCTCGAGATGTCTAATGTGTCCACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007744.1-433s1c1
Sequence:CCGGCCAAATCATGGATGCAGTGATCTCGAGATCACTGCATCCATGATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007744.1-692s1c1
Sequence:CCGGACATTAGACATGGTCTTTCTTCTCGAGAAGAAAGACCATGTCTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007744.3-880s21c1
Sequence:CCGGCGATGTGGACACATTAGACATCTCGAGATGTCTAATGTGTCCACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007744.3-682s21c1
Sequence:CCGGGCTAGGAGCTTATTGTGGCTACTCGAGTAGCCACAATAAGCTCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007744.3-631s21c1
Sequence:CCGGCCAAATCATGGATGCAGTGATCTCGAGATCACTGCATCCATGATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326511    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007744.3-1268s21c1
Sequence:CCGGGATTGTCATACACTGGCACATCTCGAGATGTGCCAGTGTATGACAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks