EMAIL THIS PAGE TO A FRIEND

COMTD1

catechol-O-methyltransferase domain containing 1

49 Gene Product Result for
UniProtKB ID: Q86VU5, Q8TE79
Gene ID:
Mouse(69156) catechol-O-methyltransferase domain containing 1
Rat(305685) catechol-O-methyltransferase domain containing 1
Zebrafish(568094) catechol-O-methyltransferase domain containing 1
chicken(423730) catechol-O-methyltransferase domain containing 1
dog(489057) catechol-O-methyltransferase domain containing 1
cow(514949) catechol-O-methyltransferase domain containing 1
domestic cat(101093048) catechol-O-methyltransferase domain containing 1
domestic guinea pig(100724117) catechol-O-methyltransferase domain containing 1
naked mole-rat(101724179) catechol-O-methyltransferase domain containing 1
sheep(101103946) catechol-O-methyltransferase domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026965 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026965 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026965 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144589 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144589 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144589 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU006461 MISSION® esiRNA esiRNA targeting mouse Comtd1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144589 Rosetta Predictions human pricing
NM_001107249 Rosetta Predictions rat pricing
NM_026965 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144589 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231822 predicted 371
2 SASI_Hs01_00231823 predicted 399
3 SASI_Hs01_00231824 predicted 372
4 SASI_Hs01_00231825 predicted 526
5 SASI_Hs01_00231826 predicted 526
6 SASI_Hs01_00231827 predicted 237
7 SASI_Hs01_00231828 predicted 626
8 SASI_Hs01_00231829 predicted 692
9 SASI_Hs01_00231831 predicted 601
10 SASI_Hs02_00364380 predicted 528
11 SASI_Hs01_00231830 predicted 378
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107249 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226975 predicted 1167
2 SASI_Rn02_00226976 predicted 1304
3 SASI_Rn02_00226977 predicted 1030
4 SASI_Rn02_00226978 predicted 912
5 SASI_Rn02_00226979 predicted 731
6 SASI_Rn02_00226980 predicted 1258
7 SASI_Rn02_00226981 predicted 862
8 SASI_Rn02_00226982 predicted 902
9 SASI_Rn02_00226983 predicted 1068
10 SASI_Rn02_00226984 predicted 969
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026965 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086782 predicted 982
2 SASI_Mm01_00086783 predicted 707
3 SASI_Mm01_00086784 predicted 532
4 SASI_Mm01_00086785 predicted 706
5 SASI_Mm01_00086786 predicted 816
6 SASI_Mm01_00086787 predicted 1225
7 SASI_Mm01_00086788 predicted 800
8 SASI_Mm02_00331286 predicted 1057
9 SASI_Mm01_00086789 predicted 718
10 SASI_Mm01_00086790 predicted 320
11 SASI_Mm01_00086791 predicted 1008
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026965
VALIDATED
COMTD1 MISSION shRNA Bacterial Glycerol Stock
catechol-O-methyltransferase domain containing 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438401    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026965.2-1002s21c1
Sequence:CCGGGCCTTATCTGACCGCATAGTTCTCGAGAACTATGCGGTCAGATAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026965.2-737s21c1
Sequence:CCGGGAACCTGAACGAACGCATCCTCTCGAGAGGATGCGTTCGTTCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026965.2-283s21c1
Sequence:CCGGGGGATTCCATGATGACCTGTGCTCGAGCACAGGTCATCATGGAATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026965.2-827s21c1
Sequence:CCGGGGGTTAACACGAAGCTTAGGGCTCGAGCCCTAAGCTTCGTGTTAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026965.2-562s21c1
Sequence:CCGGAGGCCGGAACCTTCGACATAGCTCGAGCTATGTCGAAGGTTCCGGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026965.1-1150s1c1
Sequence:CCGGGCTGGCAGTCTACTCATGTTTCTCGAGAAACATGAGTAGACTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026965.1-593s1c1
Sequence:CCGGACGCGGACAAAGAGAACTGTACTCGAGTACAGTTCTCTTTGTCCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026965.1-804s1c1
Sequence:CCGGCCTCTCCTTGGCCTTTAAGATCTCGAGATCTTAAAGGCCAAGGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026965.1-709s1c1
Sequence:CCGGCCCAGGAACAAGACTGTTGAACTCGAGTTCAACAGTCTTGTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026965
VALIDATED
COMTD1 MISSION shRNA shRNA Plasmid DNA
catechol-O-methyltransferase domain containing 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438401    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026965.2-1002s21c1
Sequence:CCGGGCCTTATCTGACCGCATAGTTCTCGAGAACTATGCGGTCAGATAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026965.2-737s21c1
Sequence:CCGGGAACCTGAACGAACGCATCCTCTCGAGAGGATGCGTTCGTTCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026965.2-283s21c1
Sequence:CCGGGGGATTCCATGATGACCTGTGCTCGAGCACAGGTCATCATGGAATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026965.2-827s21c1
Sequence:CCGGGGGTTAACACGAAGCTTAGGGCTCGAGCCCTAAGCTTCGTGTTAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026965.2-562s21c1
Sequence:CCGGAGGCCGGAACCTTCGACATAGCTCGAGCTATGTCGAAGGTTCCGGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026965.1-1150s1c1
Sequence:CCGGGCTGGCAGTCTACTCATGTTTCTCGAGAAACATGAGTAGACTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026965.1-593s1c1
Sequence:CCGGACGCGGACAAAGAGAACTGTACTCGAGTACAGTTCTCTTTGTCCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026965.1-804s1c1
Sequence:CCGGCCTCTCCTTGGCCTTTAAGATCTCGAGATCTTAAAGGCCAAGGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026965.1-709s1c1
Sequence:CCGGCCCAGGAACAAGACTGTTGAACTCGAGTTCAACAGTCTTGTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026965
VALIDATED
COMTD1 MISSION shRNA Lentiviral Transduction Particles
catechol-O-methyltransferase domain containing 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438401    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026965.2-1002s21c1
Sequence:CCGGGCCTTATCTGACCGCATAGTTCTCGAGAACTATGCGGTCAGATAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026965.2-737s21c1
Sequence:CCGGGAACCTGAACGAACGCATCCTCTCGAGAGGATGCGTTCGTTCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026965.2-283s21c1
Sequence:CCGGGGGATTCCATGATGACCTGTGCTCGAGCACAGGTCATCATGGAATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026965.2-827s21c1
Sequence:CCGGGGGTTAACACGAAGCTTAGGGCTCGAGCCCTAAGCTTCGTGTTAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026965.2-562s21c1
Sequence:CCGGAGGCCGGAACCTTCGACATAGCTCGAGCTATGTCGAAGGTTCCGGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026965.1-1150s1c1
Sequence:CCGGGCTGGCAGTCTACTCATGTTTCTCGAGAAACATGAGTAGACTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026965.1-593s1c1
Sequence:CCGGACGCGGACAAAGAGAACTGTACTCGAGTACAGTTCTCTTTGTCCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026965.1-804s1c1
Sequence:CCGGCCTCTCCTTGGCCTTTAAGATCTCGAGATCTTAAAGGCCAAGGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026965.1-709s1c1
Sequence:CCGGCCCAGGAACAAGACTGTTGAACTCGAGTTCAACAGTCTTGTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144589
COMTD1 MISSION shRNA Bacterial Glycerol Stock
catechol-O-methyltransferase domain containing 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144589.2-769s21c1
Sequence:CCGGGCCGAGTGTGTGCGAAACCTACTCGAGTAGGTTTCGCACACACTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144589.2-638s21c1
Sequence:CCGGATGCGGACAAGGAGAACTGCTCTCGAGAGCAGTTCTCCTTGTCCGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144589.2-737s21c1
Sequence:CCGGAGGTGCTGCAACCTCCGAAAGCTCGAGCTTTCGGAGGTTGCAGCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144589.2-252s21c1
Sequence:CCGGGTATCTTCTGAGCCGCTCCATCTCGAGATGGAGCGGCTCAGAAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144589.2-806s21c1
Sequence:CCGGGGGACGTCAGGGTCTACATCACTCGAGTGATGTAGACCCTGACGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144589.2-546s21c1
Sequence:CCGGCAAGATCGACCTCCGGCTGAACTCGAGTTCAGCCGGAGGTCGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144589.2-843s1c2
Sequence:CCGGCGATGGACTCACCTTGGCCTTCTCGAGAAGGCCAAGGTGAGTCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144589.2-843s1c1
Sequence:CCGGCGATGGACTCACCTTGGCCTTCTCGAGAAGGCCAAGGTGAGTCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144589.2-378s1c1
Sequence:CCGGGCGGCTCATCCAGGCCAAGAACTCGAGTTCTTGGCCTGGATGAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144589.2-238s1c1
Sequence:CCGGAGCCGCCTGTGGCAGTATCTTCTCGAGAAGATACTGCCACAGGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144589.2-780s1c1
Sequence:CCGGGCGAAACCTAAACGAACGCATCTCGAGATGCGTTCGTTTAGGTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144589
COMTD1 MISSION shRNA shRNA Plasmid DNA
catechol-O-methyltransferase domain containing 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144589.2-769s21c1
Sequence:CCGGGCCGAGTGTGTGCGAAACCTACTCGAGTAGGTTTCGCACACACTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144589.2-638s21c1
Sequence:CCGGATGCGGACAAGGAGAACTGCTCTCGAGAGCAGTTCTCCTTGTCCGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144589.2-737s21c1
Sequence:CCGGAGGTGCTGCAACCTCCGAAAGCTCGAGCTTTCGGAGGTTGCAGCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144589.2-252s21c1
Sequence:CCGGGTATCTTCTGAGCCGCTCCATCTCGAGATGGAGCGGCTCAGAAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144589.2-806s21c1
Sequence:CCGGGGGACGTCAGGGTCTACATCACTCGAGTGATGTAGACCCTGACGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144589.2-546s21c1
Sequence:CCGGCAAGATCGACCTCCGGCTGAACTCGAGTTCAGCCGGAGGTCGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144589.2-843s1c2
Sequence:CCGGCGATGGACTCACCTTGGCCTTCTCGAGAAGGCCAAGGTGAGTCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144589.2-843s1c1
Sequence:CCGGCGATGGACTCACCTTGGCCTTCTCGAGAAGGCCAAGGTGAGTCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144589.2-378s1c1
Sequence:CCGGGCGGCTCATCCAGGCCAAGAACTCGAGTTCTTGGCCTGGATGAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144589.2-238s1c1
Sequence:CCGGAGCCGCCTGTGGCAGTATCTTCTCGAGAAGATACTGCCACAGGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144589.2-780s1c1
Sequence:CCGGGCGAAACCTAAACGAACGCATCTCGAGATGCGTTCGTTTAGGTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144589
COMTD1 MISSION shRNA Lentiviral Transduction Particles
catechol-O-methyltransferase domain containing 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144589.2-769s21c1
Sequence:CCGGGCCGAGTGTGTGCGAAACCTACTCGAGTAGGTTTCGCACACACTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144589.2-638s21c1
Sequence:CCGGATGCGGACAAGGAGAACTGCTCTCGAGAGCAGTTCTCCTTGTCCGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144589.2-737s21c1
Sequence:CCGGAGGTGCTGCAACCTCCGAAAGCTCGAGCTTTCGGAGGTTGCAGCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144589.2-252s21c1
Sequence:CCGGGTATCTTCTGAGCCGCTCCATCTCGAGATGGAGCGGCTCAGAAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144589.2-806s21c1
Sequence:CCGGGGGACGTCAGGGTCTACATCACTCGAGTGATGTAGACCCTGACGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144589.2-546s21c1
Sequence:CCGGCAAGATCGACCTCCGGCTGAACTCGAGTTCAGCCGGAGGTCGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144589.2-843s1c2
Sequence:CCGGCGATGGACTCACCTTGGCCTTCTCGAGAAGGCCAAGGTGAGTCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144589.2-843s1c1
Sequence:CCGGCGATGGACTCACCTTGGCCTTCTCGAGAAGGCCAAGGTGAGTCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144589.2-378s1c1
Sequence:CCGGGCGGCTCATCCAGGCCAAGAACTCGAGTTCTTGGCCTGGATGAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144589.2-238s1c1
Sequence:CCGGAGCCGCCTGTGGCAGTATCTTCTCGAGAAGATACTGCCACAGGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144589.2-780s1c1
Sequence:CCGGGCGAAACCTAAACGAACGCATCTCGAGATGCGTTCGTTTAGGTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks