EMAIL THIS PAGE TO A FRIEND

COPA

coatomer protein complex, subunit alpha

96 Gene Product Result for
Synonyms: HEP-COP
UniProtKB ID: P53621, Q5T201, Q8IXZ9
Gene ID:
Human(1314) Summary: In eukaryotic cells, protein transport between the endoplasmic reticulum and Golgi compartments is mediated in part by non-clathrin-coated vesicular coat proteins (COPs). Seven coat proteins have been identified, and they represent subunits of a complex known as coatomer. The subunits are designated alpha-COP, beta-COP, beta-prime-COP, gamma-COP, delta-COP, epsilon-COP, and zeta-COP. The alpha-COP, encoded by COPA, shares high sequence similarity with RET1P, the alpha subunit of the coatomer complex in yeast. Also, the N-terminal 25 amino acids of alpha-COP encode the bioactive peptide, xenin, which stimulates exocrine pancreatic secretion and may act as a gastrointestinal hormone. Alternative splicing results in multiple splice forms encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Mouse(12847) coatomer protein complex subunit alpha
Rat(304978) coatomer protein complex subunit alpha
Zebrafish(260439) coatomer protein complex, subunit alpha
domestic cat(101090837) coatomer protein complex, subunit alpha
cow(100126041) coatomer protein complex, subunit alpha
dog(478973) coatomer protein complex, subunit alpha
chicken(426906) coatomer protein complex, subunit alpha
sheep(101120034) coatomer protein complex, subunit alpha
naked mole-rat(101717477) coatomer protein complex, subunit alpha
domestic guinea pig(100731367) coatomer protein complex, subunit alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2501979 Anti-COPA antibody produced in goat affinity isolated antibody, buffered aqueous solution human, bovine, pig, mouse, rat
ELISA, western blot pricing
AV51893 Anti-COPA antibody produced in rabbit affinity isolated antibody mouse, bovine, human, zebrafish, guinea pig, rat, horse, rabbit
western blot pricing
SAB2100466 Anti-COPA antibody produced in rabbit affinity isolated antibody horse, mouse, guinea pig, human, rabbit, zebrafish, rat, bovine
western blot pricing
HPA028024 Anti-COPA antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, human, rat
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004371 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004371 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004371 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009938 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009938 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009938 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU025781 MISSION® esiRNA esiRNA human COPA (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098398 Rosetta Predictions human pricing
NM_004371 Rosetta Predictions human pricing
NM_001134540 Rosetta Predictions rat pricing
XM_222899 Rosetta Predictions rat pricing
NM_009938 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098398 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318788 predicted 3347
2 SASI_Hs02_00318789 predicted 3621
3 SASI_Hs02_00318790 predicted 3679
4 SASI_Hs02_00318791 predicted 1482
5 SASI_Hs02_00318792 predicted 4008
6 SASI_Hs02_00318793 predicted 654
7 SASI_Hs02_00318794 predicted 1203
8 SASI_Hs02_00318795 predicted 1472
9 SASI_Hs02_00318796 predicted 418
10 SASI_Hs02_00318797 predicted 1171
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004371 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064881 predicted 3319
2 SASI_Hs02_00337446 predicted 3593
3 SASI_Hs01_00064882 predicted 3658
4 SASI_Hs02_00337447 predicted 1484
5 SASI_Hs01_00064883 predicted 3982
6 SASI_Hs01_00064884 predicted 650
7 SASI_Hs01_00064885 predicted 1203
8 SASI_Hs02_00337448 predicted 1473
9 SASI_Hs02_00337449 predicted 426
10 SASI_Hs02_00337450 predicted 1177
11 SASI_Hs01_00064880 predicted 638
12 SASI_Hs01_00064886 predicted 2660
13 SASI_Hs01_00064887 predicted 1853
14 SASI_Hs01_00064888 predicted 2677
15 SASI_Hs01_00064889 predicted 2857
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134540 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256889 predicted 1998
2 SASI_Rn02_00256890 predicted 2496
3 SASI_Rn02_00256891 predicted 2842
4 SASI_Rn02_00256892 predicted 2848
5 SASI_Rn02_00256893 predicted 1813
6 SASI_Rn02_00256894 predicted 1510
7 SASI_Rn02_00256895 predicted 2178
8 SASI_Rn02_00256896 predicted 1265
9 SASI_Rn02_00256897 predicted 888
10 SASI_Rn02_00256898 predicted 1961
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_222899 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00190132 predicted 2302
2 SASI_Rn01_00190133 predicted 1998
3 SASI_Rn01_00190134 predicted 2504
4 SASI_Rn01_00190135 predicted 2848
5 SASI_Rn01_00190136 predicted 2854
6 SASI_Rn01_00190137 predicted 1819
7 SASI_Rn01_00190138 predicted 1507
8 SASI_Rn01_00190139 predicted 2179
9 SASI_Rn01_00190140 predicted 1972
10 SASI_Rn01_00190141 predicted 1270
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009938 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128398 predicted 3728
2 SASI_Mm01_00128399 predicted 229
3 SASI_Mm01_00128400 predicted 2837
4 SASI_Mm01_00128401 predicted 2156
5 SASI_Mm01_00128402 predicted 268
6 SASI_Mm01_00128403 predicted 1188
7 SASI_Mm01_00128404 predicted 648
8 SASI_Mm01_00128405 predicted 500
9 SASI_Mm01_00128406 predicted 2312
10 SASI_Mm01_00128407 predicted 2260
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004371
VALIDATED
COPA MISSION shRNA Bacterial Glycerol Stock
coatomer protein complex, subunit alpha
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_004371.2-4045s1c1
Sequence:CCGGCCCTGAGTTCAAAGGTCAAATCTCGAGATTTGACCTTTGAACTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004371.2-1871s1c1
Sequence:CCGGGCGGACTCTATCACACTCTTTCTCGAGAAAGAGTGTGATAGAGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004371.2-3637s1c1
Sequence:CCGGCCGTGAGTACATTGTGGGTTTCTCGAGAAACCCACAATGTACTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_004371.2-2890s1c1
Sequence:CCGGGCCTTTATTGACTGTATCCAACTCGAGTTGGATACAGTCAATAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004371.2-1258s1c1
Sequence:CCGGCCTCAGCAATTCTGAGGACAACTCGAGTTGTCCTCAGAATTGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004371.3-786s21c1
Sequence:GTACCGGTAACAGGGCACAACCATTATGCTCGAGCATAATGGTTGTGCCCTGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004371.3-1320s21c1
Sequence:GTACCGGGCCATGATGGTGGTATGATTGCTCGAGCAATCATACCACCATCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004371.3-2514s21c1
Sequence:GTACCGGATCTTATCACTGGCAACTTAGCTCGAGCTAAGTTGCCAGTGATAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369891    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004371.3-4264s21c1
Sequence:CCGGTGACTACAGTTGTGCTCATAACTCGAGTTATGAGCACAACTGTAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004371.3-662s21c1
Sequence:CCGGCTTGGGCACTTAGATTATATTCTCGAGAATATAATCTAAGTGCCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004371.3-867s21c1
Sequence:CCGGCTGTGCGCGTTTGGGATATTTCTCGAGAAATATCCCAAACGCGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004371.3-4289s21c1
Sequence:CCGGCCTTGCCTTTCCAGCTTAATTCTCGAGAATTAAGCTGGAAAGGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004371.3-2252s21c1
Sequence:CCGGCTAGTTGGCCAGTCTATTATTCTCGAGAATAATAGACTGGCCAACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004371.3-3855s21c1
Sequence:CCGGATGCCTACCAGCTCAATTATGCTCGAGCATAATTGAGCTGGTAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004371.3-3565s21c1
Sequence:CCGGCCGTGAGTACATTGTGGGTTTCTCGAGAAACCCACAATGTACTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004371.3-2747s21c1
Sequence:CCGGATCCCAGACATTGACCCTAATCTCGAGATTAGGGTCAATGTCTGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004371.3-3057s21c1
Sequence:GTACCGGTCCCTCCTGAGCTGGATATATCTCGAGATATATCCAGCTCAGGAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004371.3-2027s21c1
Sequence:GTACCGGACAAGCAACCACATCAAATATCTCGAGATATTTGATGTGGTTGCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004371
VALIDATED
COPA MISSION shRNA shRNA Plasmid DNA
coatomer protein complex, subunit alpha
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_004371.2-4045s1c1
Sequence:CCGGCCCTGAGTTCAAAGGTCAAATCTCGAGATTTGACCTTTGAACTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004371.2-1871s1c1
Sequence:CCGGGCGGACTCTATCACACTCTTTCTCGAGAAAGAGTGTGATAGAGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004371.2-3637s1c1
Sequence:CCGGCCGTGAGTACATTGTGGGTTTCTCGAGAAACCCACAATGTACTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_004371.2-2890s1c1
Sequence:CCGGGCCTTTATTGACTGTATCCAACTCGAGTTGGATACAGTCAATAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004371.2-1258s1c1
Sequence:CCGGCCTCAGCAATTCTGAGGACAACTCGAGTTGTCCTCAGAATTGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004371.3-786s21c1
Sequence:GTACCGGTAACAGGGCACAACCATTATGCTCGAGCATAATGGTTGTGCCCTGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004371.3-1320s21c1
Sequence:GTACCGGGCCATGATGGTGGTATGATTGCTCGAGCAATCATACCACCATCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004371.3-2514s21c1
Sequence:GTACCGGATCTTATCACTGGCAACTTAGCTCGAGCTAAGTTGCCAGTGATAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369891    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004371.3-4264s21c1
Sequence:CCGGTGACTACAGTTGTGCTCATAACTCGAGTTATGAGCACAACTGTAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004371.3-662s21c1
Sequence:CCGGCTTGGGCACTTAGATTATATTCTCGAGAATATAATCTAAGTGCCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004371.3-867s21c1
Sequence:CCGGCTGTGCGCGTTTGGGATATTTCTCGAGAAATATCCCAAACGCGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004371.3-4289s21c1
Sequence:CCGGCCTTGCCTTTCCAGCTTAATTCTCGAGAATTAAGCTGGAAAGGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004371.3-2252s21c1
Sequence:CCGGCTAGTTGGCCAGTCTATTATTCTCGAGAATAATAGACTGGCCAACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004371.3-3855s21c1
Sequence:CCGGATGCCTACCAGCTCAATTATGCTCGAGCATAATTGAGCTGGTAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004371.3-3565s21c1
Sequence:CCGGCCGTGAGTACATTGTGGGTTTCTCGAGAAACCCACAATGTACTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004371.3-2747s21c1
Sequence:CCGGATCCCAGACATTGACCCTAATCTCGAGATTAGGGTCAATGTCTGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004371.3-3057s21c1
Sequence:GTACCGGTCCCTCCTGAGCTGGATATATCTCGAGATATATCCAGCTCAGGAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004371.3-2027s21c1
Sequence:GTACCGGACAAGCAACCACATCAAATATCTCGAGATATTTGATGTGGTTGCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004371
VALIDATED
COPA MISSION shRNA Lentiviral Transduction Particles
coatomer protein complex, subunit alpha
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_004371.2-4045s1c1
Sequence:CCGGCCCTGAGTTCAAAGGTCAAATCTCGAGATTTGACCTTTGAACTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004371.2-1871s1c1
Sequence:CCGGGCGGACTCTATCACACTCTTTCTCGAGAAAGAGTGTGATAGAGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004371.2-3637s1c1
Sequence:CCGGCCGTGAGTACATTGTGGGTTTCTCGAGAAACCCACAATGTACTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_004371.2-2890s1c1
Sequence:CCGGGCCTTTATTGACTGTATCCAACTCGAGTTGGATACAGTCAATAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004371.2-1258s1c1
Sequence:CCGGCCTCAGCAATTCTGAGGACAACTCGAGTTGTCCTCAGAATTGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004371.3-786s21c1
Sequence:GTACCGGTAACAGGGCACAACCATTATGCTCGAGCATAATGGTTGTGCCCTGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004371.3-1320s21c1
Sequence:GTACCGGGCCATGATGGTGGTATGATTGCTCGAGCAATCATACCACCATCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004371.3-2514s21c1
Sequence:GTACCGGATCTTATCACTGGCAACTTAGCTCGAGCTAAGTTGCCAGTGATAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369891    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004371.3-4264s21c1
Sequence:CCGGTGACTACAGTTGTGCTCATAACTCGAGTTATGAGCACAACTGTAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004371.3-662s21c1
Sequence:CCGGCTTGGGCACTTAGATTATATTCTCGAGAATATAATCTAAGTGCCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004371.3-867s21c1
Sequence:CCGGCTGTGCGCGTTTGGGATATTTCTCGAGAAATATCCCAAACGCGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004371.3-4289s21c1
Sequence:CCGGCCTTGCCTTTCCAGCTTAATTCTCGAGAATTAAGCTGGAAAGGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004371.3-2252s21c1
Sequence:CCGGCTAGTTGGCCAGTCTATTATTCTCGAGAATAATAGACTGGCCAACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004371.3-3855s21c1
Sequence:CCGGATGCCTACCAGCTCAATTATGCTCGAGCATAATTGAGCTGGTAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004371.3-3565s21c1
Sequence:CCGGCCGTGAGTACATTGTGGGTTTCTCGAGAAACCCACAATGTACTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004371.3-2747s21c1
Sequence:CCGGATCCCAGACATTGACCCTAATCTCGAGATTAGGGTCAATGTCTGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004371.3-3057s21c1
Sequence:GTACCGGTCCCTCCTGAGCTGGATATATCTCGAGATATATCCAGCTCAGGAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004371.3-2027s21c1
Sequence:GTACCGGACAAGCAACCACATCAAATATCTCGAGATATTTGATGTGGTTGCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009938
VALIDATED
COPA MISSION shRNA Bacterial Glycerol Stock
coatomer protein complex, subunit alpha
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113145    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009938.2-4094s1c1
Sequence:CCGGCCAGTACGAGACAGAAGGATTCTCGAGAATCCTTCTGTCTCGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009938.2-1106s1c1
Sequence:CCGGGCATTATGTAAAGGACCGATTCTCGAGAATCGGTCCTTTACATAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009938.2-2502s1c1
Sequence:CCGGGCACCTATCATGCCATTGGATCTCGAGATCCAATGGCATGATAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009938.2-3277s1c1
Sequence:CCGGGCCGTGAATACATTGTGGGTTCTCGAGAACCCACAATGTATTCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009938.2-2853s1c1
Sequence:CCGGCCAACGCAAATCTGGTGCAATCTCGAGATTGCACCAGATTTGCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349438    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009938.4-4368s21c1
Sequence:CCGGCCAGTACGAGACAGAAGGATTCTCGAGAATCCTTCTGTCTCGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009938.4-3842s21c1
Sequence:CCGGATGCCTGCCAGCTCAATTATGCTCGAGCATAATTGAGCTGGCAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009938.4-854s21c1
Sequence:CCGGCTGTCCGCGTTTGGGATATTTCTCGAGAAATATCCCAAACGCGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009938.4-493s21c1
Sequence:CCGGTATCGGATGTGCACCCTAATTCTCGAGAATTAGGGTGCACATCCGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009938.4-3320s21c1
Sequence:CCGGATAGTTACCCTAATCGCAATTCTCGAGAATTGCGATTAGGGTAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009938
VALIDATED
COPA MISSION shRNA shRNA Plasmid DNA
coatomer protein complex, subunit alpha
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113145    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009938.2-4094s1c1
Sequence:CCGGCCAGTACGAGACAGAAGGATTCTCGAGAATCCTTCTGTCTCGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009938.2-1106s1c1
Sequence:CCGGGCATTATGTAAAGGACCGATTCTCGAGAATCGGTCCTTTACATAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009938.2-2502s1c1
Sequence:CCGGGCACCTATCATGCCATTGGATCTCGAGATCCAATGGCATGATAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009938.2-3277s1c1
Sequence:CCGGGCCGTGAATACATTGTGGGTTCTCGAGAACCCACAATGTATTCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009938.2-2853s1c1
Sequence:CCGGCCAACGCAAATCTGGTGCAATCTCGAGATTGCACCAGATTTGCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349438    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009938.4-4368s21c1
Sequence:CCGGCCAGTACGAGACAGAAGGATTCTCGAGAATCCTTCTGTCTCGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009938.4-3842s21c1
Sequence:CCGGATGCCTGCCAGCTCAATTATGCTCGAGCATAATTGAGCTGGCAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009938.4-854s21c1
Sequence:CCGGCTGTCCGCGTTTGGGATATTTCTCGAGAAATATCCCAAACGCGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009938.4-493s21c1
Sequence:CCGGTATCGGATGTGCACCCTAATTCTCGAGAATTAGGGTGCACATCCGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009938.4-3320s21c1
Sequence:CCGGATAGTTACCCTAATCGCAATTCTCGAGAATTGCGATTAGGGTAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009938
VALIDATED
COPA MISSION shRNA Lentiviral Transduction Particles
coatomer protein complex, subunit alpha
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113145    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009938.2-4094s1c1
Sequence:CCGGCCAGTACGAGACAGAAGGATTCTCGAGAATCCTTCTGTCTCGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009938.2-1106s1c1
Sequence:CCGGGCATTATGTAAAGGACCGATTCTCGAGAATCGGTCCTTTACATAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009938.2-2502s1c1
Sequence:CCGGGCACCTATCATGCCATTGGATCTCGAGATCCAATGGCATGATAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009938.2-3277s1c1
Sequence:CCGGGCCGTGAATACATTGTGGGTTCTCGAGAACCCACAATGTATTCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009938.2-2853s1c1
Sequence:CCGGCCAACGCAAATCTGGTGCAATCTCGAGATTGCACCAGATTTGCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349438    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009938.4-4368s21c1
Sequence:CCGGCCAGTACGAGACAGAAGGATTCTCGAGAATCCTTCTGTCTCGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009938.4-3842s21c1
Sequence:CCGGATGCCTGCCAGCTCAATTATGCTCGAGCATAATTGAGCTGGCAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009938.4-854s21c1
Sequence:CCGGCTGTCCGCGTTTGGGATATTTCTCGAGAAATATCCCAAACGCGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009938.4-493s21c1
Sequence:CCGGTATCGGATGTGCACCCTAATTCTCGAGAATTAGGGTGCACATCCGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009938.4-3320s21c1
Sequence:CCGGATAGTTACCCTAATCGCAATTCTCGAGAATTGCGATTAGGGTAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks