EMAIL THIS PAGE TO A FRIEND

COPB1

coatomer protein complex, subunit beta 1

76 Gene Product Result for
Synonyms: COPB
UniProtKB ID: P53618, D3DQX0, Q6GTT7, Q9NTK2, Q9UNW7
Gene ID:
Human(1315) Summary: This gene encodes a protein subunit of the coatomer complex associated with non-clathrin coated vesicles. The coatomer complex, also known as the coat protein complex 1, forms in the cytoplasm and is recruited to the Golgi by activated guanosine triphosphatases. Once at the Golgi membrane, the coatomer complex may assist in the movement of protein and lipid components back to the endoplasmic reticulum. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2009]
Mouse(70349) coatomer protein complex, subunit beta 1
Rat(114023) coatomer protein complex, subunit beta 1
domestic guinea pig(100714651) coatomer protein complex, subunit beta 1
naked mole-rat(101723246) coatomer protein complex, subunit beta 1
sheep(101118300) coatomer protein complex, subunit beta 1
Domestic Rabbit(100352311) coatomer protein complex, subunit beta 1
Zebrafish(338138) coatomer protein complex, subunit beta 1
cow(535533) coatomer protein complex, subunit beta 1
Horse(100056177) coatomer protein complex, subunit beta 1
domestic cat(101093391) coatomer protein complex, subunit beta 1
dog(476866) coatomer protein complex, subunit beta 1
chicken(423063) coatomer protein complex, subunit beta 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV52371 Anti-COPB1 antibody produced in rabbit affinity isolated antibody canine, horse, bovine, zebrafish, human, mouse, rabbit, pig, rat, guinea pig
western blot pricing
HPA043954 Anti-COPB1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
HPA064403 Anti-COPB1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
G2279 Monoclonal Anti-β-COP antibody produced in mouse clone M3A5, ascites fluid human, rabbit, hamster, canine, monkey, bovine, rat, kangaroo rat, chicken, goose
immunocytochemistry, immunofluorescence, immunoprecipitation pricing
G6160 Monoclonal Anti-β-COP antibody produced in mouse clone maD, ascites fluid monkey, rat, human, hamster
immunofluorescence, microarray, western blot pricing
WH0001315M8 Monoclonal Anti-COPB antibody produced in mouse clone 3E10, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016451 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016451 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016451 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033370 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033370 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033370 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016451 Rosetta Predictions human pricing
NM_080781 Rosetta Predictions rat pricing
NM_033370 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016451 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349485 predicted 2169
2 SASI_Hs01_00206951 predicted 312
3 SASI_Hs02_00349486 predicted 2755
4 SASI_Hs01_00206952 predicted 1256
5 SASI_Hs02_00349487 predicted 2349
6 SASI_Hs01_00206953 predicted 2487
7 SASI_Hs01_00206954 predicted 1292
8 SASI_Hs01_00206955 predicted 1481
9 SASI_Hs01_00206956 predicted 2819
10 SASI_Hs01_00206957 predicted 2566
11 SASI_Hs01_00206958 predicted 1248
12 SASI_Hs01_00206959 predicted 2913
13 SASI_Hs01_00206960 predicted 3209
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080781 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267301 predicted 3099
2 SASI_Rn01_00039719 predicted 2338
3 SASI_Rn01_00039720 predicted 2927
4 SASI_Rn01_00039721 predicted 3066
5 SASI_Rn01_00039722 predicted 727
6 SASI_Rn01_00039723 predicted 1832
7 SASI_Rn01_00039724 predicted 2483
8 SASI_Rn01_00039725 predicted 1496
9 SASI_Rn01_00039727 predicted 2836
10 SASI_Rn01_00039728 predicted 1333
11 SASI_Rn01_00039726 predicted 829
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033370 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170396 predicted 1518
2 SASI_Mm01_00170397 predicted 2316
3 SASI_Mm01_00170398 predicted 2901
4 SASI_Mm01_00170405 predicted 2791
5 SASI_Mm02_00337342 predicted 2181
6 SASI_Mm01_00170399 predicted 1584
7 SASI_Mm01_00170400 predicted 2892
8 SASI_Mm01_00170401 predicted 3038
9 SASI_Mm01_00170402 predicted 1877
10 SASI_Mm02_00337343 predicted 1392
11 SASI_Mm01_00170403 predicted 1317
12 SASI_Mm01_00170404 predicted 789
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016451
VALIDATED
COPB1 MISSION shRNA Bacterial Glycerol Stock
coatomer protein complex, subunit beta 1
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016451.4-742s21c1
Sequence:GTACCGGGCATCGACACAGCTATGTTAGCTCGAGCTAACATAGCTGTGTCGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016451.4-3239s21c1
Sequence:CCGGTGTACTCTTTCATGCTTATATCTCGAGATATAAGCATGAAAGAGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_016451.4-2828s21c1
Sequence:CCGGCGTCAGATGTGGGCCGAATTTCTCGAGAAATTCGGCCCACATCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_016451.4-915s21c1
Sequence:CCGGATCGAGCTTTGGATTACTTAACTCGAGTTAAGTAATCCAAAGCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_016451.4-2127s21c1
Sequence:CCGGATGATGATGTGGATCGAATTTCTCGAGAAATTCGATCCACATCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_016451.4-1468s21c1
Sequence:CCGGGCATTCCTGTTCTGTCCGATTCTCGAGAATCGGACAGAACAGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_016451.4-1213s21c1
Sequence:GTACCGGGGATCGCTTGATAGAATTAAACTCGAGTTTAATTCTATCAAGCGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380319    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_016451.4-3299s21c1
Sequence:GTACCGGTTATAGCCTTTCCCTTAAATCCTCGAGGATTTAAGGGAAAGGCTATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_016451.4-3070s21c1
Sequence:GTACCGGTGCTGTTACCGGCCATATAAGCTCGAGCTTATATGGCCGGTAACAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_016451.3-1462s1c1
Sequence:CCGGGCATTCCTGTTCTGTCCGATTCTCGAGAATCGGACAGAACAGGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016451.3-2950s1c1
Sequence:CCGGCCTTTCTGGTTACTGTGGCTTCTCGAGAAGCCACAGTAACCAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151585    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_016451.3-3298s1c1
Sequence:CCGGGCCTTTCCCTTAAATCAAGATCTCGAGATCTTGATTTAAGGGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150921    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_016451.3-3255s1c1
Sequence:CCGGGAATCTGAGTTCATGCTGAATCTCGAGATTCAGCATGAACTCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_016451.3-3110s1c1
Sequence:CCGGGCCTTAAGTCTTGGAGATAAACTCGAGTTTATCTCCAAGACTTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_016451.3-2636s1c1
Sequence:CCGGCCTCATGACTTCGCAAATATTCTCGAGAATATTTGCGAAGTCATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016451.3-1619s1c1
Sequence:CCGGGAGAAGATGCTTGAAGTCTTTCTCGAGAAAGACTTCAAGCATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016451
VALIDATED
COPB1 MISSION shRNA shRNA Plasmid DNA
coatomer protein complex, subunit beta 1
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016451.4-742s21c1
Sequence:GTACCGGGCATCGACACAGCTATGTTAGCTCGAGCTAACATAGCTGTGTCGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016451.4-3239s21c1
Sequence:CCGGTGTACTCTTTCATGCTTATATCTCGAGATATAAGCATGAAAGAGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_016451.4-2828s21c1
Sequence:CCGGCGTCAGATGTGGGCCGAATTTCTCGAGAAATTCGGCCCACATCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_016451.4-915s21c1
Sequence:CCGGATCGAGCTTTGGATTACTTAACTCGAGTTAAGTAATCCAAAGCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_016451.4-2127s21c1
Sequence:CCGGATGATGATGTGGATCGAATTTCTCGAGAAATTCGATCCACATCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_016451.4-1468s21c1
Sequence:CCGGGCATTCCTGTTCTGTCCGATTCTCGAGAATCGGACAGAACAGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_016451.4-1213s21c1
Sequence:GTACCGGGGATCGCTTGATAGAATTAAACTCGAGTTTAATTCTATCAAGCGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380319    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_016451.4-3299s21c1
Sequence:GTACCGGTTATAGCCTTTCCCTTAAATCCTCGAGGATTTAAGGGAAAGGCTATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_016451.4-3070s21c1
Sequence:GTACCGGTGCTGTTACCGGCCATATAAGCTCGAGCTTATATGGCCGGTAACAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_016451.3-1462s1c1
Sequence:CCGGGCATTCCTGTTCTGTCCGATTCTCGAGAATCGGACAGAACAGGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016451.3-2950s1c1
Sequence:CCGGCCTTTCTGGTTACTGTGGCTTCTCGAGAAGCCACAGTAACCAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151585    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_016451.3-3298s1c1
Sequence:CCGGGCCTTTCCCTTAAATCAAGATCTCGAGATCTTGATTTAAGGGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150921    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_016451.3-3255s1c1
Sequence:CCGGGAATCTGAGTTCATGCTGAATCTCGAGATTCAGCATGAACTCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_016451.3-3110s1c1
Sequence:CCGGGCCTTAAGTCTTGGAGATAAACTCGAGTTTATCTCCAAGACTTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_016451.3-2636s1c1
Sequence:CCGGCCTCATGACTTCGCAAATATTCTCGAGAATATTTGCGAAGTCATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016451.3-1619s1c1
Sequence:CCGGGAGAAGATGCTTGAAGTCTTTCTCGAGAAAGACTTCAAGCATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016451
VALIDATED
COPB1 MISSION shRNA Lentiviral Transduction Particles
coatomer protein complex, subunit beta 1
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016451.4-742s21c1
Sequence:GTACCGGGCATCGACACAGCTATGTTAGCTCGAGCTAACATAGCTGTGTCGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016451.4-3239s21c1
Sequence:CCGGTGTACTCTTTCATGCTTATATCTCGAGATATAAGCATGAAAGAGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_016451.4-2828s21c1
Sequence:CCGGCGTCAGATGTGGGCCGAATTTCTCGAGAAATTCGGCCCACATCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_016451.4-915s21c1
Sequence:CCGGATCGAGCTTTGGATTACTTAACTCGAGTTAAGTAATCCAAAGCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_016451.4-2127s21c1
Sequence:CCGGATGATGATGTGGATCGAATTTCTCGAGAAATTCGATCCACATCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_016451.4-1468s21c1
Sequence:CCGGGCATTCCTGTTCTGTCCGATTCTCGAGAATCGGACAGAACAGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_016451.4-1213s21c1
Sequence:GTACCGGGGATCGCTTGATAGAATTAAACTCGAGTTTAATTCTATCAAGCGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380319    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_016451.4-3299s21c1
Sequence:GTACCGGTTATAGCCTTTCCCTTAAATCCTCGAGGATTTAAGGGAAAGGCTATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_016451.4-3070s21c1
Sequence:GTACCGGTGCTGTTACCGGCCATATAAGCTCGAGCTTATATGGCCGGTAACAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_016451.3-1462s1c1
Sequence:CCGGGCATTCCTGTTCTGTCCGATTCTCGAGAATCGGACAGAACAGGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016451.3-2950s1c1
Sequence:CCGGCCTTTCTGGTTACTGTGGCTTCTCGAGAAGCCACAGTAACCAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151585    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_016451.3-3298s1c1
Sequence:CCGGGCCTTTCCCTTAAATCAAGATCTCGAGATCTTGATTTAAGGGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150921    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_016451.3-3255s1c1
Sequence:CCGGGAATCTGAGTTCATGCTGAATCTCGAGATTCAGCATGAACTCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_016451.3-3110s1c1
Sequence:CCGGGCCTTAAGTCTTGGAGATAAACTCGAGTTTATCTCCAAGACTTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_016451.3-2636s1c1
Sequence:CCGGCCTCATGACTTCGCAAATATTCTCGAGAATATTTGCGAAGTCATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016451.3-1619s1c1
Sequence:CCGGGAGAAGATGCTTGAAGTCTTTCTCGAGAAAGACTTCAAGCATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033370
VALIDATED
COPB1 MISSION shRNA Bacterial Glycerol Stock
coatomer protein complex, subunit beta 1
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033370.3-2212s21c1
Sequence:GTACCGGTGTTGGCAGCAATGGGTAATACTCGAGTATTACCCATTGCTGCCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033370.3-2655s21c1
Sequence:CCGGCGTCAGATGTGGGCCGAATTTCTCGAGAAATTCGGCCCACATCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033370.3-2897s21c1
Sequence:CCGGTGCCGTTACTGGCCATATAAGCTCGAGCTTATATGGCCAGTAACGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033370.3-1954s21c1
Sequence:CCGGATGATGATGTAGATCGAATTTCTCGAGAAATTCGATCTACATCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349885    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033370.3-3116s21c1
Sequence:CCGGATGCATTCCAGCCAGTAATTTCTCGAGAAATTACTGGCTGGAATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033370.3-651s21c1
Sequence:CCGGGCTCCTGAACTGATACATGATCTCGAGATCATGTATCAGTTCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033370.3-569s21c1
Sequence:GTACCGGACATCGTCACAGCTATGTTAGCTCGAGCTAACATAGCTGTGACGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033370.3-740s21c1
Sequence:GTACCGGGGATCGAGCTTTGGATTATTTCTCGAGAAATAATCCAAAGCTCGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113180    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033370.2-3147s1c1
Sequence:CCGGCCCTAAATCAAGAATGAGTTTCTCGAGAAACTCATTCTTGATTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033370.2-2826s1c1
Sequence:CCGGCGTTCTATATTTGGAGAGGATCTCGAGATCCTCTCCAAATATAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_033370.2-1329s1c1
Sequence:CCGGGCAAATGTTATTCCTGTGTTACTCGAGTAACACAGGAATAACATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033370.2-651s1c1
Sequence:CCGGGCTCCTGAACTGATACATGATCTCGAGATCATGTATCAGTTCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033370.2-1806s1c1
Sequence:CCGGGCCACAACTCTAACCAAGATTCTCGAGAATCTTGGTTAGAGTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033370
VALIDATED
COPB1 MISSION shRNA shRNA Plasmid DNA
coatomer protein complex, subunit beta 1
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033370.3-2212s21c1
Sequence:GTACCGGTGTTGGCAGCAATGGGTAATACTCGAGTATTACCCATTGCTGCCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033370.3-2655s21c1
Sequence:CCGGCGTCAGATGTGGGCCGAATTTCTCGAGAAATTCGGCCCACATCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033370.3-2897s21c1
Sequence:CCGGTGCCGTTACTGGCCATATAAGCTCGAGCTTATATGGCCAGTAACGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033370.3-1954s21c1
Sequence:CCGGATGATGATGTAGATCGAATTTCTCGAGAAATTCGATCTACATCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349885    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033370.3-3116s21c1
Sequence:CCGGATGCATTCCAGCCAGTAATTTCTCGAGAAATTACTGGCTGGAATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033370.3-651s21c1
Sequence:CCGGGCTCCTGAACTGATACATGATCTCGAGATCATGTATCAGTTCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033370.3-569s21c1
Sequence:GTACCGGACATCGTCACAGCTATGTTAGCTCGAGCTAACATAGCTGTGACGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033370.3-740s21c1
Sequence:GTACCGGGGATCGAGCTTTGGATTATTTCTCGAGAAATAATCCAAAGCTCGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113180    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033370.2-3147s1c1
Sequence:CCGGCCCTAAATCAAGAATGAGTTTCTCGAGAAACTCATTCTTGATTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033370.2-2826s1c1
Sequence:CCGGCGTTCTATATTTGGAGAGGATCTCGAGATCCTCTCCAAATATAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_033370.2-1329s1c1
Sequence:CCGGGCAAATGTTATTCCTGTGTTACTCGAGTAACACAGGAATAACATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033370.2-651s1c1
Sequence:CCGGGCTCCTGAACTGATACATGATCTCGAGATCATGTATCAGTTCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033370.2-1806s1c1
Sequence:CCGGGCCACAACTCTAACCAAGATTCTCGAGAATCTTGGTTAGAGTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033370
VALIDATED
COPB1 MISSION shRNA Lentiviral Transduction Particles
coatomer protein complex, subunit beta 1
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033370.3-2212s21c1
Sequence:GTACCGGTGTTGGCAGCAATGGGTAATACTCGAGTATTACCCATTGCTGCCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033370.3-2655s21c1
Sequence:CCGGCGTCAGATGTGGGCCGAATTTCTCGAGAAATTCGGCCCACATCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033370.3-2897s21c1
Sequence:CCGGTGCCGTTACTGGCCATATAAGCTCGAGCTTATATGGCCAGTAACGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033370.3-1954s21c1
Sequence:CCGGATGATGATGTAGATCGAATTTCTCGAGAAATTCGATCTACATCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349885    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033370.3-3116s21c1
Sequence:CCGGATGCATTCCAGCCAGTAATTTCTCGAGAAATTACTGGCTGGAATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033370.3-651s21c1
Sequence:CCGGGCTCCTGAACTGATACATGATCTCGAGATCATGTATCAGTTCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033370.3-569s21c1
Sequence:GTACCGGACATCGTCACAGCTATGTTAGCTCGAGCTAACATAGCTGTGACGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033370.3-740s21c1
Sequence:GTACCGGGGATCGAGCTTTGGATTATTTCTCGAGAAATAATCCAAAGCTCGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113180    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033370.2-3147s1c1
Sequence:CCGGCCCTAAATCAAGAATGAGTTTCTCGAGAAACTCATTCTTGATTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033370.2-2826s1c1
Sequence:CCGGCGTTCTATATTTGGAGAGGATCTCGAGATCCTCTCCAAATATAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_033370.2-1329s1c1
Sequence:CCGGGCAAATGTTATTCCTGTGTTACTCGAGTAACACAGGAATAACATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033370.2-651s1c1
Sequence:CCGGGCTCCTGAACTGATACATGATCTCGAGATCATGTATCAGTTCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033370.2-1806s1c1
Sequence:CCGGGCCACAACTCTAACCAAGATTCTCGAGAATCTTGGTTAGAGTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks