EMAIL THIS PAGE TO A FRIEND

COPB2

coatomer protein complex, subunit beta 2 (beta prime)

61 Gene Product Result for
Synonyms: beta'-COP
UniProtKB ID: P35606
Gene ID:
Human(9276) Summary: The Golgi coatomer complex (see MIM 601924) constitutes the coat of nonclathrin-coated vesicles and is essential for Golgi budding and vesicular trafficking. It consists of 7 protein subunits, including COPB2.[supplied by OMIM, Jul 2002]
Mouse(50797) coatomer protein complex, subunit beta 2 (beta prime)
Rat(60384) coatomer protein complex, subunit beta 2 (beta prime)
Zebrafish(114454) coatomer protein complex, subunit beta 2
cow(281706) coatomer protein complex, subunit beta 2 (beta prime)
Horse(100063990) coatomer protein complex, subunit beta 2 (beta prime)
domestic cat(101090961) coatomer protein complex, subunit beta 2 (beta prime)
dog(477088) coatomer protein complex, subunit beta 2 (beta prime)
chicken(424823) coatomer protein complex, subunit beta 2 (beta prime)
sheep(101109234) coatomer protein complex, subunit beta 2 (beta prime)
naked mole-rat(101717102) coatomer protein complex, subunit beta 2 (beta prime)
domestic guinea pig(100729674) coatomer protein complex, subunit beta 2 (beta prime)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004766 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004766 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004766 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_015827 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015827 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015827 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU033981 MISSION® esiRNA esiRNA human COPB2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004766 Rosetta Predictions human pricing
NR_023350 Rosetta Predictions human pricing
NM_021765 Rosetta Predictions rat pricing
NM_015827 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004766 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193269 predicted 2042
2 SASI_Hs01_00193271 predicted 1160
3 SASI_Hs01_00193272 predicted 1734
4 SASI_Hs02_00338264 predicted 210
5 SASI_Hs01_00193274 predicted 1911
6 SASI_Hs02_00338265 predicted 2849
7 SASI_Hs01_00193275 predicted 1861
8 SASI_Hs02_00338266 predicted 2572
9 SASI_Hs01_00193277 predicted 1880
10 SASI_Hs02_00338267 predicted 270
11 SASI_Hs01_00193268 predicted 1688
12 SASI_Hs01_00193270 predicted 2736
13 SASI_Hs01_00193273 predicted 1628
14 SASI_Hs01_00193276 predicted 422
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_023350 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00381752 predicted 2115
2 SASI_Hs02_00381753 predicted 1241
3 SASI_Hs02_00381754 predicted 1807
4 SASI_Hs02_00381755 predicted 283
5 SASI_Hs02_00381756 predicted 1991
6 SASI_Hs02_00381757 predicted 2925
7 SASI_Hs02_00381758 predicted 1942
8 SASI_Hs02_00381759 predicted 2647
9 SASI_Hs02_00381760 predicted 1955
10 SASI_Hs02_00381761 predicted 349
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021765 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050624 predicted 2736
2 SASI_Rn01_00050627 predicted 1163
3 SASI_Rn01_00050628 predicted 1868
4 SASI_Rn01_00050629 predicted 2652
5 SASI_Rn02_00262826 predicted 229
6 SASI_Rn01_00050630 predicted 1153
7 SASI_Rn01_00050631 predicted 2098
8 SASI_Rn01_00050632 predicted 493
9 SASI_Rn01_00050633 predicted 384
10 SASI_Rn02_00262827 predicted 1023
11 SASI_Rn01_00050625 predicted 1695
12 SASI_Rn01_00050626 predicted 1601
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015827 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154963 predicted 2806
2 SASI_Mm01_00154964 predicted 2786
3 SASI_Mm01_00154966 predicted 1695
4 SASI_Mm02_00323246 predicted 2680
5 SASI_Mm01_00154967 predicted 1873
6 SASI_Mm01_00154968 predicted 515
7 SASI_Mm01_00154969 predicted 2746
8 SASI_Mm01_00154970 predicted 1642
9 SASI_Mm01_00154971 predicted 1988
10 SASI_Mm01_00154972 predicted 2452
11 SASI_Mm01_00154965 predicted 387
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004766
VALIDATED
COPB2 MISSION shRNA Bacterial Glycerol Stock
coatomer protein complex, subunit beta 2 (beta prime)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004766.1-305s1c1
Sequence:CCGGGCAGATTAGAGTGTTCAATTACTCGAGTAATTGAACACTCTAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_004766.1-2097s1c1
Sequence:CCGGGCCATTAGTAAATGTCAGTTTCTCGAGAAACTGACATTTACTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_004766.1-1131s1c1
Sequence:CCGGCCTCAGACTATTCAGCACAATCTCGAGATTGTGCTGAATAGTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004766.1-2526s1c1
Sequence:CCGGCCAGCCAAACAATACCCACTTCTCGAGAAGTGGGTATTGTTTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004766.1-1257s1c1
Sequence:CCGGGCCCACGATTCTTCAGAGTATCTCGAGATACTCTGAAGAATCGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004766.2-367s21c1
Sequence:CCGGGCAGATTAGAGTGTTCAATTACTCGAGTAATTGAACACTCTAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004766.2-1319s21c1
Sequence:CCGGGCCCACGATTCTTCAGAGTATCTCGAGATACTCTGAAGAATCGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004766.2-543s21c1
Sequence:GTACCGGTTGAAGGACACACCCATTATGCTCGAGCATAATGGGTGTGTCCTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004766.2-1565s21c1
Sequence:CCGGATTGCTACTGAGGAATCATTTCTCGAGAAATGATTCCTCAGTAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293939    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_004766.2-2871s21c1
Sequence:CCGGCCTGACTAAACAGATCATTATCTCGAGATAATGATCTGTTTAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004766.2-166s21c1
Sequence:CCGGTGCTAGATCTGATCGAGTTAACTCGAGTTAACTCGATCAGATCTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004766.2-843s21c1
Sequence:GTACCGGATCCTGAGTTGCCAATCATTACTCGAGTAATGATTGGCAACTCAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004766
VALIDATED
COPB2 MISSION shRNA shRNA Plasmid DNA
coatomer protein complex, subunit beta 2 (beta prime)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004766.1-305s1c1
Sequence:CCGGGCAGATTAGAGTGTTCAATTACTCGAGTAATTGAACACTCTAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_004766.1-2097s1c1
Sequence:CCGGGCCATTAGTAAATGTCAGTTTCTCGAGAAACTGACATTTACTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_004766.1-1131s1c1
Sequence:CCGGCCTCAGACTATTCAGCACAATCTCGAGATTGTGCTGAATAGTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004766.1-2526s1c1
Sequence:CCGGCCAGCCAAACAATACCCACTTCTCGAGAAGTGGGTATTGTTTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004766.1-1257s1c1
Sequence:CCGGGCCCACGATTCTTCAGAGTATCTCGAGATACTCTGAAGAATCGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004766.2-367s21c1
Sequence:CCGGGCAGATTAGAGTGTTCAATTACTCGAGTAATTGAACACTCTAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004766.2-1319s21c1
Sequence:CCGGGCCCACGATTCTTCAGAGTATCTCGAGATACTCTGAAGAATCGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004766.2-543s21c1
Sequence:GTACCGGTTGAAGGACACACCCATTATGCTCGAGCATAATGGGTGTGTCCTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004766.2-1565s21c1
Sequence:CCGGATTGCTACTGAGGAATCATTTCTCGAGAAATGATTCCTCAGTAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293939    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_004766.2-2871s21c1
Sequence:CCGGCCTGACTAAACAGATCATTATCTCGAGATAATGATCTGTTTAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004766.2-166s21c1
Sequence:CCGGTGCTAGATCTGATCGAGTTAACTCGAGTTAACTCGATCAGATCTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004766.2-843s21c1
Sequence:GTACCGGATCCTGAGTTGCCAATCATTACTCGAGTAATGATTGGCAACTCAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004766
VALIDATED
COPB2 MISSION shRNA Lentiviral Transduction Particles
coatomer protein complex, subunit beta 2 (beta prime)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004766.1-305s1c1
Sequence:CCGGGCAGATTAGAGTGTTCAATTACTCGAGTAATTGAACACTCTAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_004766.1-2097s1c1
Sequence:CCGGGCCATTAGTAAATGTCAGTTTCTCGAGAAACTGACATTTACTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_004766.1-1131s1c1
Sequence:CCGGCCTCAGACTATTCAGCACAATCTCGAGATTGTGCTGAATAGTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004766.1-2526s1c1
Sequence:CCGGCCAGCCAAACAATACCCACTTCTCGAGAAGTGGGTATTGTTTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004766.1-1257s1c1
Sequence:CCGGGCCCACGATTCTTCAGAGTATCTCGAGATACTCTGAAGAATCGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004766.2-367s21c1
Sequence:CCGGGCAGATTAGAGTGTTCAATTACTCGAGTAATTGAACACTCTAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004766.2-1319s21c1
Sequence:CCGGGCCCACGATTCTTCAGAGTATCTCGAGATACTCTGAAGAATCGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004766.2-543s21c1
Sequence:GTACCGGTTGAAGGACACACCCATTATGCTCGAGCATAATGGGTGTGTCCTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004766.2-1565s21c1
Sequence:CCGGATTGCTACTGAGGAATCATTTCTCGAGAAATGATTCCTCAGTAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293939    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_004766.2-2871s21c1
Sequence:CCGGCCTGACTAAACAGATCATTATCTCGAGATAATGATCTGTTTAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004766.2-166s21c1
Sequence:CCGGTGCTAGATCTGATCGAGTTAACTCGAGTTAACTCGATCAGATCTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004766.2-843s21c1
Sequence:GTACCGGATCCTGAGTTGCCAATCATTACTCGAGTAATGATTGGCAACTCAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015827
VALIDATED
COPB2 MISSION shRNA Bacterial Glycerol Stock
coatomer protein complex, subunit beta 2 (beta prime)
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113175    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015827.1-2866s1c1
Sequence:CCGGCCTGACCAGAACTTTGGAAATCTCGAGATTTCCAAAGTTCTGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_015827.1-1991s1c1
Sequence:CCGGGCACTTACAGTATCCACAGATCTCGAGATCTGTGGATACTGTAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_015827.1-386s1c1
Sequence:CCGGTCGGATTACATTCGTTGTATTCTCGAGAATACAACGAATGTAATCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_015827.1-545s1c1
Sequence:CCGGCCCAAAGATAACAATCAGTTTCTCGAGAAACTGATTGTTATCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015827.1-652s1c1
Sequence:CCGGCGTGAATTGCATTGACTACTACTCGAGTAGTAGTCAATGCAATTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015827.2-1159s21c1
Sequence:CCGGACCATTCAGCACAATCCTAATCTCGAGATTAGGATTGTGCTGAATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380784    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015827.2-2860s21c1
Sequence:CCGGACCATCCTGACCAGAACTTTGCTCGAGCAAAGTTCTGGTCAGGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015827.2-2744s21c1
Sequence:CCGGACTTGGAATTAGAGGATATTGCTCGAGCAATATCCTCTAATTCCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015827.2-1771s21c1
Sequence:CCGGATGTATCTTCTGGGCTATATTCTCGAGAATATAGCCCAGAAGATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015827.2-126s21c1
Sequence:CCGGTGCTAGGTCTGACCGAGTTAACTCGAGTTAACTCGGTCAGACCTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345391    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015827.2-2821s21c1
Sequence:CCGGACTGCAGTAAGAGATTATTATCTCGAGATAATAATCTCTTACTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015827.2-876s21c1
Sequence:CCGGGCTTGAGAGCACGCTGAATTACTCGAGTAATTCAGCGTGCTCTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374911    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015827.2-2810s21c1
Sequence:CCGGGTTTGCCATTTACTGCAGTAACTCGAGTTACTGCAGTAAATGGCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015827.2-138s21c1
Sequence:CCGGCCGAGTTAAGAGCGTGGATTTCTCGAGAAATCCACGCTCTTAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015827.2-1373s21c1
Sequence:CCGGTTGGAGCTGAAAGTATCTATGCTCGAGCATAGATACTTTCAGCTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015827
VALIDATED
COPB2 MISSION shRNA shRNA Plasmid DNA
coatomer protein complex, subunit beta 2 (beta prime)
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113175    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015827.1-2866s1c1
Sequence:CCGGCCTGACCAGAACTTTGGAAATCTCGAGATTTCCAAAGTTCTGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_015827.1-1991s1c1
Sequence:CCGGGCACTTACAGTATCCACAGATCTCGAGATCTGTGGATACTGTAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_015827.1-386s1c1
Sequence:CCGGTCGGATTACATTCGTTGTATTCTCGAGAATACAACGAATGTAATCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_015827.1-545s1c1
Sequence:CCGGCCCAAAGATAACAATCAGTTTCTCGAGAAACTGATTGTTATCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015827.1-652s1c1
Sequence:CCGGCGTGAATTGCATTGACTACTACTCGAGTAGTAGTCAATGCAATTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015827.2-1159s21c1
Sequence:CCGGACCATTCAGCACAATCCTAATCTCGAGATTAGGATTGTGCTGAATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380784    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015827.2-2860s21c1
Sequence:CCGGACCATCCTGACCAGAACTTTGCTCGAGCAAAGTTCTGGTCAGGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015827.2-2744s21c1
Sequence:CCGGACTTGGAATTAGAGGATATTGCTCGAGCAATATCCTCTAATTCCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015827.2-1771s21c1
Sequence:CCGGATGTATCTTCTGGGCTATATTCTCGAGAATATAGCCCAGAAGATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015827.2-126s21c1
Sequence:CCGGTGCTAGGTCTGACCGAGTTAACTCGAGTTAACTCGGTCAGACCTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345391    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015827.2-2821s21c1
Sequence:CCGGACTGCAGTAAGAGATTATTATCTCGAGATAATAATCTCTTACTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015827.2-876s21c1
Sequence:CCGGGCTTGAGAGCACGCTGAATTACTCGAGTAATTCAGCGTGCTCTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374911    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015827.2-2810s21c1
Sequence:CCGGGTTTGCCATTTACTGCAGTAACTCGAGTTACTGCAGTAAATGGCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015827.2-138s21c1
Sequence:CCGGCCGAGTTAAGAGCGTGGATTTCTCGAGAAATCCACGCTCTTAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015827.2-1373s21c1
Sequence:CCGGTTGGAGCTGAAAGTATCTATGCTCGAGCATAGATACTTTCAGCTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015827
VALIDATED
COPB2 MISSION shRNA Lentiviral Transduction Particles
coatomer protein complex, subunit beta 2 (beta prime)
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113175    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015827.1-2866s1c1
Sequence:CCGGCCTGACCAGAACTTTGGAAATCTCGAGATTTCCAAAGTTCTGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_015827.1-1991s1c1
Sequence:CCGGGCACTTACAGTATCCACAGATCTCGAGATCTGTGGATACTGTAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_015827.1-386s1c1
Sequence:CCGGTCGGATTACATTCGTTGTATTCTCGAGAATACAACGAATGTAATCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_015827.1-545s1c1
Sequence:CCGGCCCAAAGATAACAATCAGTTTCTCGAGAAACTGATTGTTATCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015827.1-652s1c1
Sequence:CCGGCGTGAATTGCATTGACTACTACTCGAGTAGTAGTCAATGCAATTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015827.2-1159s21c1
Sequence:CCGGACCATTCAGCACAATCCTAATCTCGAGATTAGGATTGTGCTGAATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380784    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015827.2-2860s21c1
Sequence:CCGGACCATCCTGACCAGAACTTTGCTCGAGCAAAGTTCTGGTCAGGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015827.2-2744s21c1
Sequence:CCGGACTTGGAATTAGAGGATATTGCTCGAGCAATATCCTCTAATTCCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015827.2-1771s21c1
Sequence:CCGGATGTATCTTCTGGGCTATATTCTCGAGAATATAGCCCAGAAGATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015827.2-126s21c1
Sequence:CCGGTGCTAGGTCTGACCGAGTTAACTCGAGTTAACTCGGTCAGACCTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345391    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015827.2-2821s21c1
Sequence:CCGGACTGCAGTAAGAGATTATTATCTCGAGATAATAATCTCTTACTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015827.2-876s21c1
Sequence:CCGGGCTTGAGAGCACGCTGAATTACTCGAGTAATTCAGCGTGCTCTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374911    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015827.2-2810s21c1
Sequence:CCGGGTTTGCCATTTACTGCAGTAACTCGAGTTACTGCAGTAAATGGCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015827.2-138s21c1
Sequence:CCGGCCGAGTTAAGAGCGTGGATTTCTCGAGAAATCCACGCTCTTAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015827.2-1373s21c1
Sequence:CCGGTTGGAGCTGAAAGTATCTATGCTCGAGCATAGATACTTTCAGCTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks