EMAIL THIS PAGE TO A FRIEND

COPE

coatomer protein complex, subunit epsilon

73 Gene Product Result for
Synonyms: epsilon-COP
UniProtKB ID: O14579, A6NE29, A6NKA3, O76097, Q6IBB8, Q9UGP6
Gene ID:
Human(11316) Summary: The product of this gene is an epsilon subunit of coatomer protein complex. Coatomer is a cytosolic protein complex that binds to dilysine motifs and reversibly associates with Golgi non-clathrin-coated vesicles. It is required for budding from Golgi membranes, and is essential for the retrograde Golgi-to-ER transport of dilysine-tagged proteins. Coatomer complex consists of at least the alpha, beta, beta', gamma, delta, epsilon and zeta subunits. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(59042) coatomer protein complex, subunit epsilon
Rat(290659) coatomer protein complex, subunit epsilon
Zebrafish(492492) coatomer protein complex, subunit epsilon
Horse(100069610) coatomer protein complex, subunit epsilon
cow(338085) coatomer protein complex, subunit epsilon
domestic cat(101089336) coatomer protein complex, subunit epsilon
chicken(420117) coatomer protein complex, subunit epsilon
dog(476663) coatomer protein complex, subunit epsilon
domestic guinea pig(100714371) coatomer protein complex, subunit epsilon
naked mole-rat(101706146) coatomer protein complex, subunit epsilon
sheep(101107594) coatomer protein complex, subunit epsilon
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007263 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007263 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007263 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021538 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021538 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021538 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007263 Rosetta Predictions human pricing
NM_199442 Rosetta Predictions human pricing
NM_199444 Rosetta Predictions human pricing
NM_001106076 Rosetta Predictions rat pricing
NM_021538 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007263 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071653 predicted 787
2 SASI_Hs01_00071654 predicted 884
3 SASI_Hs01_00071655 predicted 755
4 SASI_Hs01_00071656 predicted 910
5 SASI_Hs01_00071657 predicted 879
6 SASI_Hs01_00071658 predicted 838
7 SASI_Hs01_00071660 predicted 788
8 SASI_Hs01_00071661 predicted 752
9 SASI_Hs01_00071662 predicted 782
10 SASI_Hs02_00343297 predicted 765
11 SASI_Hs01_00071659 predicted 851
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199442 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093829 predicted 628
2 SASI_Hs01_00093830 predicted 728
3 SASI_Hs01_00093831 predicted 605
4 SASI_Hs01_00093832 predicted 756
5 SASI_Hs01_00093833 predicted 726
6 SASI_Hs01_00093834 predicted 690
7 SASI_Hs01_00093836 predicted 632
8 SASI_Hs01_00093837 predicted 603
9 SASI_Hs01_00093838 predicted 630
10 SASI_Hs02_00372854 predicted 619
11 SASI_Hs01_00093835 predicted 698
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199444 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082264 predicted 286
2 SASI_Hs01_00082265 predicted 359
3 SASI_Hs01_00082266 predicted 396
4 SASI_Hs01_00082267 predicted 284
5 SASI_Hs01_00082268 predicted 214
6 SASI_Hs01_00082269 predicted 288
7 SASI_Hs01_00082270 predicted 343
8 SASI_Hs01_00082271 predicted 210
9 SASI_Hs01_00082272 predicted 280
10 SASI_Hs02_00372856 predicted 372
11 SASI_Hs01_00082273 predicted 343
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106076 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215392 predicted 339
2 SASI_Rn02_00215393 predicted 447
3 SASI_Rn02_00215394 predicted 577
4 SASI_Rn02_00215395 predicted 275
5 SASI_Rn02_00215396 predicted 395
6 SASI_Rn02_00215397 predicted 326
7 SASI_Rn02_00215398 predicted 515
8 SASI_Rn02_00215399 predicted 532
9 SASI_Rn02_00215400 predicted 533
10 SASI_Rn02_00215401 predicted 352
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021538 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119993 predicted 621
2 SASI_Mm01_00119994 predicted 457
3 SASI_Mm02_00326277 predicted 283
4 SASI_Mm01_00119995 predicted 474
5 SASI_Mm02_00326278 predicted 769
6 SASI_Mm02_00326279 predicted 780
7 SASI_Mm01_00119997 predicted 609
8 SASI_Mm02_00326280 predicted 615
9 SASI_Mm01_00119998 predicted 389
10 SASI_Mm01_00119999 predicted 348
11 SASI_Mm01_00119996 predicted 356
12 SASI_Mm01_00120000 predicted 363
13 SASI_Mm01_00120001 predicted 551
14 SASI_Mm01_00120002 predicted 340
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007263
VALIDATED
COPE MISSION shRNA Bacterial Glycerol Stock
coatomer protein complex, subunit epsilon
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_007263.3-638s21c1
Sequence:GTACCGGAGGATGCCTACTACATCTTCCCTCGAGGGAAGATGTAGTAGGCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_007263.3-129s21c1
Sequence:CCGGCAGCTACCAGCAGTGCATAAACTCGAGTTTATGCACTGCTGGTAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_007263.3-93s21c1
Sequence:CCGGCGAGCTGTTCGACGTAAAGAACTCGAGTTCTTTACGTCGAACAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007263.3-201s21c1
Sequence:CCGGCGTCTTCCTGTATAGAGCGTACTCGAGTACGCTCTATACAGGAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007263.3-291s21c1
Sequence:CCGGCGTGCGCATGTTTGCTGACTACTCGAGTAGTCAGCAAACATGCGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_007263.3-914s21c1
Sequence:CCGGAGGCCAAGGAGAACGACTTTGCTCGAGCAAAGTCGTTCTCCTTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_007263.3-245s21c1
Sequence:GTACCGGTGGTCCTGGATGAGATCAAGCCTCGAGGCTTGATCTCATCCAGGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007263.3-201s1c1
Sequence:CCGGCGTCTTCCTGTATAGAGCGTACTCGAGTACGCTCTATACAGGAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_007263.3-291s1c1
Sequence:CCGGCGTGCGCATGTTTGCTGACTACTCGAGTAGTCAGCAAACATGCGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_007263.3-891s1c1
Sequence:CCGGCCATCCCTTCATCAAGGAGTACTCGAGTACTCCTTGATGAAGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_007263.3-768s1c1
Sequence:CCGGGCTAGACAAGGATAGTGGCTACTCGAGTAGCCACTATCCTTGTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_007263.3-93s1c1
Sequence:CCGGCGAGCTGTTCGACGTAAAGAACTCGAGTTCTTTACGTCGAACAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007263
VALIDATED
COPE MISSION shRNA shRNA Plasmid DNA
coatomer protein complex, subunit epsilon
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_007263.3-638s21c1
Sequence:GTACCGGAGGATGCCTACTACATCTTCCCTCGAGGGAAGATGTAGTAGGCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_007263.3-129s21c1
Sequence:CCGGCAGCTACCAGCAGTGCATAAACTCGAGTTTATGCACTGCTGGTAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_007263.3-93s21c1
Sequence:CCGGCGAGCTGTTCGACGTAAAGAACTCGAGTTCTTTACGTCGAACAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007263.3-201s21c1
Sequence:CCGGCGTCTTCCTGTATAGAGCGTACTCGAGTACGCTCTATACAGGAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007263.3-291s21c1
Sequence:CCGGCGTGCGCATGTTTGCTGACTACTCGAGTAGTCAGCAAACATGCGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_007263.3-914s21c1
Sequence:CCGGAGGCCAAGGAGAACGACTTTGCTCGAGCAAAGTCGTTCTCCTTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_007263.3-245s21c1
Sequence:GTACCGGTGGTCCTGGATGAGATCAAGCCTCGAGGCTTGATCTCATCCAGGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007263.3-201s1c1
Sequence:CCGGCGTCTTCCTGTATAGAGCGTACTCGAGTACGCTCTATACAGGAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_007263.3-291s1c1
Sequence:CCGGCGTGCGCATGTTTGCTGACTACTCGAGTAGTCAGCAAACATGCGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_007263.3-891s1c1
Sequence:CCGGCCATCCCTTCATCAAGGAGTACTCGAGTACTCCTTGATGAAGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_007263.3-768s1c1
Sequence:CCGGGCTAGACAAGGATAGTGGCTACTCGAGTAGCCACTATCCTTGTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_007263.3-93s1c1
Sequence:CCGGCGAGCTGTTCGACGTAAAGAACTCGAGTTCTTTACGTCGAACAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007263
VALIDATED
COPE MISSION shRNA Lentiviral Transduction Particles
coatomer protein complex, subunit epsilon
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_007263.3-638s21c1
Sequence:GTACCGGAGGATGCCTACTACATCTTCCCTCGAGGGAAGATGTAGTAGGCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_007263.3-129s21c1
Sequence:CCGGCAGCTACCAGCAGTGCATAAACTCGAGTTTATGCACTGCTGGTAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_007263.3-93s21c1
Sequence:CCGGCGAGCTGTTCGACGTAAAGAACTCGAGTTCTTTACGTCGAACAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007263.3-201s21c1
Sequence:CCGGCGTCTTCCTGTATAGAGCGTACTCGAGTACGCTCTATACAGGAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007263.3-291s21c1
Sequence:CCGGCGTGCGCATGTTTGCTGACTACTCGAGTAGTCAGCAAACATGCGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_007263.3-914s21c1
Sequence:CCGGAGGCCAAGGAGAACGACTTTGCTCGAGCAAAGTCGTTCTCCTTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_007263.3-245s21c1
Sequence:GTACCGGTGGTCCTGGATGAGATCAAGCCTCGAGGCTTGATCTCATCCAGGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007263.3-201s1c1
Sequence:CCGGCGTCTTCCTGTATAGAGCGTACTCGAGTACGCTCTATACAGGAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_007263.3-291s1c1
Sequence:CCGGCGTGCGCATGTTTGCTGACTACTCGAGTAGTCAGCAAACATGCGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_007263.3-891s1c1
Sequence:CCGGCCATCCCTTCATCAAGGAGTACTCGAGTACTCCTTGATGAAGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_007263.3-768s1c1
Sequence:CCGGGCTAGACAAGGATAGTGGCTACTCGAGTAGCCACTATCCTTGTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_007263.3-93s1c1
Sequence:CCGGCGAGCTGTTCGACGTAAAGAACTCGAGTTCTTTACGTCGAACAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021538
VALIDATED
COPE MISSION shRNA Bacterial Glycerol Stock
coatomer protein complex, subunit epsilon
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021538.1-774s21c1
Sequence:GTACCGGAGACCCTCATCAATCTCATTGCTCGAGCAATGAGATTGATGAGGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021538.1-82s21c1
Sequence:CCGGCGACGTGAAGAACGCTTTCTACTCGAGTAGAAAGCGTTCTTCACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021538.1-835s21c1
Sequence:CCGGCCGATACTTGTCACAGCTGAACTCGAGTTCAGCTGTGACAAGTATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021538.1-613s21c1
Sequence:CCGGGCTACAAGAAGCCTACTACATCTCGAGATGTAGTAGGCTTCTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021538.1-351s21c1
Sequence:GTACCGGGGAGTGTGGATGTGACCAATACTCGAGTATTGGTCACATCCACACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021538.1-275s21c1
Sequence:CCGGCGCATGTTTGCTGAGTACCTTCTCGAGAAGGTACTCAGCAAACATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021538.1-82s1c1
Sequence:CCGGCGACGTGAAGAACGCTTTCTACTCGAGTAGAAAGCGTTCTTCACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021538.1-275s1c1
Sequence:CCGGCGCATGTTTGCTGAGTACCTTCTCGAGAAGGTACTCAGCAAACATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021538.1-613s1c1
Sequence:CCGGGCTACAAGAAGCCTACTACATCTCGAGATGTAGTAGGCTTCTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021538.1-776s1c1
Sequence:CCGGACCCTCATCAATCTCATTGTACTCGAGTACAATGAGATTGATGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021538.1-835s1c1
Sequence:CCGGCCGATACTTGTCACAGCTGAACTCGAGTTCAGCTGTGACAAGTATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021538
VALIDATED
COPE MISSION shRNA shRNA Plasmid DNA
coatomer protein complex, subunit epsilon
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021538.1-774s21c1
Sequence:GTACCGGAGACCCTCATCAATCTCATTGCTCGAGCAATGAGATTGATGAGGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021538.1-82s21c1
Sequence:CCGGCGACGTGAAGAACGCTTTCTACTCGAGTAGAAAGCGTTCTTCACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021538.1-835s21c1
Sequence:CCGGCCGATACTTGTCACAGCTGAACTCGAGTTCAGCTGTGACAAGTATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021538.1-613s21c1
Sequence:CCGGGCTACAAGAAGCCTACTACATCTCGAGATGTAGTAGGCTTCTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021538.1-351s21c1
Sequence:GTACCGGGGAGTGTGGATGTGACCAATACTCGAGTATTGGTCACATCCACACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021538.1-275s21c1
Sequence:CCGGCGCATGTTTGCTGAGTACCTTCTCGAGAAGGTACTCAGCAAACATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021538.1-82s1c1
Sequence:CCGGCGACGTGAAGAACGCTTTCTACTCGAGTAGAAAGCGTTCTTCACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021538.1-275s1c1
Sequence:CCGGCGCATGTTTGCTGAGTACCTTCTCGAGAAGGTACTCAGCAAACATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021538.1-613s1c1
Sequence:CCGGGCTACAAGAAGCCTACTACATCTCGAGATGTAGTAGGCTTCTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021538.1-776s1c1
Sequence:CCGGACCCTCATCAATCTCATTGTACTCGAGTACAATGAGATTGATGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021538.1-835s1c1
Sequence:CCGGCCGATACTTGTCACAGCTGAACTCGAGTTCAGCTGTGACAAGTATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021538
VALIDATED
COPE MISSION shRNA Lentiviral Transduction Particles
coatomer protein complex, subunit epsilon
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021538.1-774s21c1
Sequence:GTACCGGAGACCCTCATCAATCTCATTGCTCGAGCAATGAGATTGATGAGGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021538.1-82s21c1
Sequence:CCGGCGACGTGAAGAACGCTTTCTACTCGAGTAGAAAGCGTTCTTCACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021538.1-835s21c1
Sequence:CCGGCCGATACTTGTCACAGCTGAACTCGAGTTCAGCTGTGACAAGTATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021538.1-613s21c1
Sequence:CCGGGCTACAAGAAGCCTACTACATCTCGAGATGTAGTAGGCTTCTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021538.1-351s21c1
Sequence:GTACCGGGGAGTGTGGATGTGACCAATACTCGAGTATTGGTCACATCCACACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021538.1-275s21c1
Sequence:CCGGCGCATGTTTGCTGAGTACCTTCTCGAGAAGGTACTCAGCAAACATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021538.1-82s1c1
Sequence:CCGGCGACGTGAAGAACGCTTTCTACTCGAGTAGAAAGCGTTCTTCACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021538.1-275s1c1
Sequence:CCGGCGCATGTTTGCTGAGTACCTTCTCGAGAAGGTACTCAGCAAACATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021538.1-613s1c1
Sequence:CCGGGCTACAAGAAGCCTACTACATCTCGAGATGTAGTAGGCTTCTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021538.1-776s1c1
Sequence:CCGGACCCTCATCAATCTCATTGTACTCGAGTACAATGAGATTGATGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021538.1-835s1c1
Sequence:CCGGCCGATACTTGTCACAGCTGAACTCGAGTTCAGCTGTGACAAGTATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks