EMAIL THIS PAGE TO A FRIEND

COPG1

coatomer protein complex, subunit gamma 1

70 Gene Product Result for
Synonyms: COPG
UniProtKB ID: Q9Y678, A8K6M8, B3KMF6, Q54AC4
Gene ID:
Mouse(54161) coatomer protein complex, subunit gamma 1
Rat(297428) coatomer protein complex, subunit gamma 1
dog(476517) coatomer protein complex, subunit gamma 1
cow(338055) coatomer protein complex, subunit gamma
domestic cat(101085446) coatomer protein complex, subunit gamma 1
naked mole-rat(101698988) coatomer protein complex, subunit gamma 1
domestic guinea pig(100718549) coatomer protein complex, subunit gamma 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_201244 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_201244 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_201244 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016128 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016128 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016128 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016128 Rosetta Predictions human pricing
NM_001031822 Rosetta Predictions rat pricing
NM_017477 Rosetta Predictions mouse pricing
NM_201244 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016128 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348918 predicted 1062
2 SASI_Hs01_00036686 predicted 1600
3 SASI_Hs01_00036687 predicted 2526
4 SASI_Hs01_00036688 predicted 1720
5 SASI_Hs01_00036689 predicted 1612
6 SASI_Hs01_00036690 predicted 1273
7 SASI_Hs01_00036693 predicted 2101
8 SASI_Hs02_00348919 predicted 2405
9 SASI_Hs01_00036695 predicted 1732
10 SASI_Hs02_00348920 predicted 518
11 SASI_Hs01_00036691 predicted 2500
12 SASI_Hs01_00036692 predicted 1284
13 SASI_Hs01_00036694 predicted 1794
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031822 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095662 predicted 1181
2 SASI_Rn01_00095663 predicted 1715
3 SASI_Rn01_00095664 predicted 2263
4 SASI_Rn01_00095665 predicted 627
5 SASI_Rn01_00095666 predicted 1259
6 SASI_Rn01_00095667 predicted 1581
7 SASI_Rn01_00095669 predicted 256
8 SASI_Rn01_00095670 predicted 2061
9 SASI_Rn01_00095671 predicted 1167
10 SASI_Rn02_00203610 predicted 2175
11 SASI_Rn01_00095668 predicted 2253
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017477 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096154 predicted 1678
2 SASI_Mm01_00096156 predicted 2062
3 SASI_Mm01_00096157 predicted 717
4 SASI_Mm01_00096158 predicted 1161
5 SASI_Mm01_00096159 predicted 1092
6 SASI_Mm01_00096160 predicted 1356
7 SASI_Mm02_00323944 predicted 2089
8 SASI_Mm01_00096161 predicted 1490
9 SASI_Mm01_00096162 predicted 2270
10 SASI_Mm01_00096163 predicted 1179
11 SASI_Mm01_00096155 predicted 1591
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201244 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124239 predicted 519
2 SASI_Mm01_00124240 predicted 400
3 SASI_Mm01_00124241 predicted 436
4 SASI_Mm01_00124242 predicted 575
5 SASI_Mm01_00124243 predicted 310
6 SASI_Mm01_00124244 predicted 423
7 SASI_Mm01_00124245 predicted 581
8 SASI_Mm01_00124246 predicted 458
9 SASI_Mm01_00124247 predicted 416
10 SASI_Mm01_00124248 predicted 313
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201244
VALIDATED
COPG1 MISSION shRNA Bacterial Glycerol Stock
coatomer protein complex, subunit gamma 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100760    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201244.1-505s1c1
Sequence:CCGGGCCTCTAGAATGGTCTGCTTACTCGAGTAAGCAGACCATTCTAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_201244.1-155s1c1
Sequence:CCGGGCTCGGGTCTTTAACGAAACTCTCGAGAGTTTCGTTAAAGACCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_201244.1-257s1c1
Sequence:CCGGGAAGCAACTGAGGCTTTCTTTCTCGAGAAAGAAAGCCTCAGTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_201244.1-319s1c1
Sequence:CCGGCCGCATGTGCTATTTGACCATCTCGAGATGGTCAAATAGCACATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_201244.1-210s1c1
Sequence:CCGGCCAAGATCCTTTATCTCATAACTCGAGTTATGAGATAAAGGATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_201244.1-210s21c1
Sequence:CCGGCCAAGATCCTTTATCTCATAACTCGAGTTATGAGATAAAGGATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201244.1-319s21c1
Sequence:CCGGCCGCATGTGCTATTTGACCATCTCGAGATGGTCAAATAGCACATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_201244.1-148s21c1
Sequence:CCGGCCAAGAGGCTCGGGTCTTTAACTCGAGTTAAAGACCCGAGCCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201244.1-695s21c1
Sequence:CCGGGGGACAGACGTCACGAATATACTCGAGTATATTCGTGACGTCTGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_201244.1-257s21c1
Sequence:CCGGGAAGCAACTGAGGCTTTCTTTCTCGAGAAAGAAAGCCTCAGTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380404    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201244.1-638s21c1
Sequence:CCGGAGTTAATGAGCAAGTCTATTACTCGAGTAATAGACTTGCTCATTAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201244
VALIDATED
COPG1 MISSION shRNA shRNA Plasmid DNA
coatomer protein complex, subunit gamma 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100760    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201244.1-505s1c1
Sequence:CCGGGCCTCTAGAATGGTCTGCTTACTCGAGTAAGCAGACCATTCTAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_201244.1-155s1c1
Sequence:CCGGGCTCGGGTCTTTAACGAAACTCTCGAGAGTTTCGTTAAAGACCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_201244.1-257s1c1
Sequence:CCGGGAAGCAACTGAGGCTTTCTTTCTCGAGAAAGAAAGCCTCAGTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_201244.1-319s1c1
Sequence:CCGGCCGCATGTGCTATTTGACCATCTCGAGATGGTCAAATAGCACATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_201244.1-210s1c1
Sequence:CCGGCCAAGATCCTTTATCTCATAACTCGAGTTATGAGATAAAGGATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_201244.1-210s21c1
Sequence:CCGGCCAAGATCCTTTATCTCATAACTCGAGTTATGAGATAAAGGATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201244.1-319s21c1
Sequence:CCGGCCGCATGTGCTATTTGACCATCTCGAGATGGTCAAATAGCACATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_201244.1-148s21c1
Sequence:CCGGCCAAGAGGCTCGGGTCTTTAACTCGAGTTAAAGACCCGAGCCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201244.1-695s21c1
Sequence:CCGGGGGACAGACGTCACGAATATACTCGAGTATATTCGTGACGTCTGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_201244.1-257s21c1
Sequence:CCGGGAAGCAACTGAGGCTTTCTTTCTCGAGAAAGAAAGCCTCAGTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380404    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201244.1-638s21c1
Sequence:CCGGAGTTAATGAGCAAGTCTATTACTCGAGTAATAGACTTGCTCATTAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201244
VALIDATED
COPG1 MISSION shRNA Lentiviral Transduction Particles
coatomer protein complex, subunit gamma 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100760    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201244.1-505s1c1
Sequence:CCGGGCCTCTAGAATGGTCTGCTTACTCGAGTAAGCAGACCATTCTAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_201244.1-155s1c1
Sequence:CCGGGCTCGGGTCTTTAACGAAACTCTCGAGAGTTTCGTTAAAGACCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_201244.1-257s1c1
Sequence:CCGGGAAGCAACTGAGGCTTTCTTTCTCGAGAAAGAAAGCCTCAGTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_201244.1-319s1c1
Sequence:CCGGCCGCATGTGCTATTTGACCATCTCGAGATGGTCAAATAGCACATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_201244.1-210s1c1
Sequence:CCGGCCAAGATCCTTTATCTCATAACTCGAGTTATGAGATAAAGGATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_201244.1-210s21c1
Sequence:CCGGCCAAGATCCTTTATCTCATAACTCGAGTTATGAGATAAAGGATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201244.1-319s21c1
Sequence:CCGGCCGCATGTGCTATTTGACCATCTCGAGATGGTCAAATAGCACATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_201244.1-148s21c1
Sequence:CCGGCCAAGAGGCTCGGGTCTTTAACTCGAGTTAAAGACCCGAGCCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201244.1-695s21c1
Sequence:CCGGGGGACAGACGTCACGAATATACTCGAGTATATTCGTGACGTCTGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_201244.1-257s21c1
Sequence:CCGGGAAGCAACTGAGGCTTTCTTTCTCGAGAAAGAAAGCCTCAGTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380404    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201244.1-638s21c1
Sequence:CCGGAGTTAATGAGCAAGTCTATTACTCGAGTAATAGACTTGCTCATTAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016128
VALIDATED
COPG1 MISSION shRNA Bacterial Glycerol Stock
coatomer protein complex, subunit gamma 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149699    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_016128.3-2940s1c1
Sequence:CCGGGCTTGTCCTAAATCTTGCTGTCTCGAGACAGCAAGATTTAGGACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016128.3-188s1c1
Sequence:CCGGGAGGCCCGTGTATTTAATGAACTCGAGTTCATTAAATACACGGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016128.3-1030s1c1
Sequence:CCGGCCTCAATAAGGTTGCCATGAACTCGAGTTCATGGCAACCTTATTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016128.3-2441s1c1
Sequence:CCGGGATGAATTTGAGAAGGAGGAACTCGAGTTCCTCCTTCTCAAATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016128.3-1730s1c1
Sequence:CCGGGCAGGCTATATCCTAAATGGTCTCGAGACCATTTAGGATATAGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016128.3-724s1c1
Sequence:CCGGCCTAGCCGTCAATAAGATGATCTCGAGATCATCTTATTGACGGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016128.3-1513s21c1
Sequence:GTACCGGGTACATCCGCTTCATCTATAACTCGAGTTATAGATGAAGCGGATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016128.3-211s21c1
Sequence:GTACCGGTCCCATCAACCCTCGGAAATGCTCGAGCATTTCCGAGGGTTGATGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016128.3-1273s21c1
Sequence:GTACCGGTCGCAAACACGCCGTCCTTATCTCGAGATAAGGACGGCGTGTTTGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016128.3-2545s21c1
Sequence:GTACCGGGTCAGACAAAGTGCCGGATAACTCGAGTTATCCGGCACTTTGTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016128.3-885s21c1
Sequence:GTACCGGAGCACGAGATGGTGGTGTATGCTCGAGCATACACCACCATCTCGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016128.3-1322s21c1
Sequence:GTACCGGGAGGGTGGCTTTGAGTATAAGCTCGAGCTTATACTCAAAGCCACCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016128.3-2373s21c1
Sequence:GTACCGGTTACTGTAGCTGATCACATTCCTCGAGGAATGTGATCAGCTACAGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016128
VALIDATED
COPG1 MISSION shRNA shRNA Plasmid DNA
coatomer protein complex, subunit gamma 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149699    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_016128.3-2940s1c1
Sequence:CCGGGCTTGTCCTAAATCTTGCTGTCTCGAGACAGCAAGATTTAGGACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016128.3-188s1c1
Sequence:CCGGGAGGCCCGTGTATTTAATGAACTCGAGTTCATTAAATACACGGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016128.3-1030s1c1
Sequence:CCGGCCTCAATAAGGTTGCCATGAACTCGAGTTCATGGCAACCTTATTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016128.3-2441s1c1
Sequence:CCGGGATGAATTTGAGAAGGAGGAACTCGAGTTCCTCCTTCTCAAATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016128.3-1730s1c1
Sequence:CCGGGCAGGCTATATCCTAAATGGTCTCGAGACCATTTAGGATATAGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016128.3-724s1c1
Sequence:CCGGCCTAGCCGTCAATAAGATGATCTCGAGATCATCTTATTGACGGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016128.3-1513s21c1
Sequence:GTACCGGGTACATCCGCTTCATCTATAACTCGAGTTATAGATGAAGCGGATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016128.3-211s21c1
Sequence:GTACCGGTCCCATCAACCCTCGGAAATGCTCGAGCATTTCCGAGGGTTGATGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016128.3-1273s21c1
Sequence:GTACCGGTCGCAAACACGCCGTCCTTATCTCGAGATAAGGACGGCGTGTTTGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016128.3-2545s21c1
Sequence:GTACCGGGTCAGACAAAGTGCCGGATAACTCGAGTTATCCGGCACTTTGTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016128.3-885s21c1
Sequence:GTACCGGAGCACGAGATGGTGGTGTATGCTCGAGCATACACCACCATCTCGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016128.3-1322s21c1
Sequence:GTACCGGGAGGGTGGCTTTGAGTATAAGCTCGAGCTTATACTCAAAGCCACCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016128.3-2373s21c1
Sequence:GTACCGGTTACTGTAGCTGATCACATTCCTCGAGGAATGTGATCAGCTACAGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016128
VALIDATED
COPG1 MISSION shRNA Lentiviral Transduction Particles
coatomer protein complex, subunit gamma 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149699    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_016128.3-2940s1c1
Sequence:CCGGGCTTGTCCTAAATCTTGCTGTCTCGAGACAGCAAGATTTAGGACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016128.3-188s1c1
Sequence:CCGGGAGGCCCGTGTATTTAATGAACTCGAGTTCATTAAATACACGGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016128.3-1030s1c1
Sequence:CCGGCCTCAATAAGGTTGCCATGAACTCGAGTTCATGGCAACCTTATTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016128.3-2441s1c1
Sequence:CCGGGATGAATTTGAGAAGGAGGAACTCGAGTTCCTCCTTCTCAAATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016128.3-1730s1c1
Sequence:CCGGGCAGGCTATATCCTAAATGGTCTCGAGACCATTTAGGATATAGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016128.3-724s1c1
Sequence:CCGGCCTAGCCGTCAATAAGATGATCTCGAGATCATCTTATTGACGGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016128.3-1513s21c1
Sequence:GTACCGGGTACATCCGCTTCATCTATAACTCGAGTTATAGATGAAGCGGATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016128.3-211s21c1
Sequence:GTACCGGTCCCATCAACCCTCGGAAATGCTCGAGCATTTCCGAGGGTTGATGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016128.3-1273s21c1
Sequence:GTACCGGTCGCAAACACGCCGTCCTTATCTCGAGATAAGGACGGCGTGTTTGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016128.3-2545s21c1
Sequence:GTACCGGGTCAGACAAAGTGCCGGATAACTCGAGTTATCCGGCACTTTGTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016128.3-885s21c1
Sequence:GTACCGGAGCACGAGATGGTGGTGTATGCTCGAGCATACACCACCATCTCGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016128.3-1322s21c1
Sequence:GTACCGGGAGGGTGGCTTTGAGTATAAGCTCGAGCTTATACTCAAAGCCACCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016128.3-2373s21c1
Sequence:GTACCGGTTACTGTAGCTGATCACATTCCTCGAGGAATGTGATCAGCTACAGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks