EMAIL THIS PAGE TO A FRIEND

COPG2

coatomer protein complex, subunit gamma 2

Synonyms: 2-COP
UniProtKB ID: Q9UBF2, A6NH74, Q54AC3, Q8WVW8
Gene ID:
Mouse(54160) coatomer protein complex, subunit gamma 2
Rat(301742) coatomer protein complex, subunit gamma 2
naked mole-rat(101697027) coatomer protein complex, subunit gamma 2
sheep(101117839) coatomer protein complex, subunit gamma 2
Zebrafish(30187) coatomer protein complex, subunit gamma 2
cow(536616) coatomer protein complex, subunit gamma 2
Horse(100068740) coatomer protein complex, subunit gamma 2
domestic cat(101090929) coatomer protein complex, subunit gamma 2
dog(475189) coatomer protein complex, subunit gamma 2
chicken(416685) coatomer protein complex, subunit gamma 2
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1303532 ANTI-COPG2 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
immunohistochemistry, western blot pricing
SAB2104939 Anti-COPG2, (N-terminal) antibody produced in rabbit affinity isolated antibody horse, guinea pig, human, mouse, rabbit, rat
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012133 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012133 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012133 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_017478 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_017478 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_017478 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU047681 MISSION® esiRNA esiRNA targeting mouse Copg2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012133 Rosetta Predictions human pricing
NM_001106929 Rosetta Predictions rat pricing
NM_017478 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012133 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040638 predicted 629
2 SASI_Hs01_00040640 predicted 716
3 SASI_Hs02_00343678 predicted 2557
4 SASI_Hs02_00343679 predicted 1167
5 SASI_Hs02_00343680 predicted 1648
6 SASI_Hs02_00343681 predicted 1438
7 SASI_Hs02_00343682 predicted 1100
8 SASI_Hs02_00343683 predicted 1859
9 SASI_Hs01_00040642 predicted 781
10 SASI_Hs02_00343684 predicted 1216
11 SASI_Hs01_00040637 predicted 581
12 SASI_Hs01_00040639 predicted 795
13 SASI_Hs01_00040641 predicted 329
14 SASI_Hs01_00040643 predicted 320
15 SASI_Hs01_00040644 predicted 505
16 SASI_Hs01_00040645 predicted 657
17 SASI_Hs01_00040646 predicted 612
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106929 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223796 predicted 540
2 SASI_Rn02_00223797 predicted 1556
3 SASI_Rn02_00223798 predicted 249
4 SASI_Rn02_00223799 predicted 668
5 SASI_Rn02_00223800 predicted 613
6 SASI_Rn02_00223801 predicted 447
7 SASI_Rn02_00223802 predicted 1326
8 SASI_Rn02_00223803 predicted 924
9 SASI_Rn02_00223804 predicted 1280
10 SASI_Rn02_00223805 predicted 1573
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017478 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148158 predicted 571
2 SASI_Mm01_00148159 predicted 283
3 SASI_Mm02_00323945 predicted 1087
4 SASI_Mm01_00148160 predicted 201
5 SASI_Mm01_00148161 predicted 2334
6 SASI_Mm01_00148164 predicted 1644
7 SASI_Mm01_00148165 predicted 1139
8 SASI_Mm01_00148166 predicted 2009
9 SASI_Mm01_00148167 predicted 2482
10 SASI_Mm02_00323946 predicted 1348
11 SASI_Mm01_00148162 predicted 1691
12 SASI_Mm01_00148163 predicted 2537
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012133
VALIDATED
COPG2 MISSION shRNA Bacterial Glycerol Stock
coatomer protein complex, subunit gamma 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012133.4-381s21c1
Sequence:GTACCGGCATCTCTGAGGATGTGATAATCTCGAGATTATCACATCCTCAGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012133.4-1238s21c1
Sequence:GTACCGGTTAGTGCTCTCTGTCAGAAATCTCGAGATTTCTGACAGAGAGCACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012133.4-1564s21c1
Sequence:GTACCGGGTGAGTGCTTTGGCTAAATTTCTCGAGAAATTTAGCCAAAGCACTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012133.4-2027s21c1
Sequence:GTACCGGGATGTATCAAGCACATGTTTACTCGAGTAAACATGTGCTTGATACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012133.1-2108s1c1
Sequence:CCGGCCTATGAAGTGCTGTCTTGTACTCGAGTACAAGACAGCACTTCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012133.1-170s1c1
Sequence:CCGGCTCCAATCAATCCAAGAAGATCTCGAGATCTTCTTGGATTGATTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A3
TRC Version: 1 Clone ID:NM_012133.1-1090s1c1
Sequence:CCGGGCCATTACTACACTCCTCAAACTCGAGTTTGAGGAGTGTAGTAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012133.1-1579s1c1
Sequence:CCGGCCAAGCATCCTTGTACTCTTACTCGAGTAAGAGTACAAGGATGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154576    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012133.1-1677s1c1
Sequence:CCGGGATGGCACTAAATGCCACATACTCGAGTATGTGGCATTTAGTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012133.1-1810s1c1
Sequence:CCGGGCTCCTGTCTTTGAACAGAAACTCGAGTTTCTGTTCAAAGACAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_012133.1-2613s1c1
Sequence:CCGGGCAGGTGACTGTCAGAAGTAACTCGAGTTACTTCTGACAGTCACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012133
VALIDATED
COPG2 MISSION shRNA shRNA Plasmid DNA
coatomer protein complex, subunit gamma 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012133.4-381s21c1
Sequence:GTACCGGCATCTCTGAGGATGTGATAATCTCGAGATTATCACATCCTCAGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012133.4-1238s21c1
Sequence:GTACCGGTTAGTGCTCTCTGTCAGAAATCTCGAGATTTCTGACAGAGAGCACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012133.4-1564s21c1
Sequence:GTACCGGGTGAGTGCTTTGGCTAAATTTCTCGAGAAATTTAGCCAAAGCACTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012133.4-2027s21c1
Sequence:GTACCGGGATGTATCAAGCACATGTTTACTCGAGTAAACATGTGCTTGATACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012133.1-2108s1c1
Sequence:CCGGCCTATGAAGTGCTGTCTTGTACTCGAGTACAAGACAGCACTTCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012133.1-170s1c1
Sequence:CCGGCTCCAATCAATCCAAGAAGATCTCGAGATCTTCTTGGATTGATTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A3
TRC Version: 1 Clone ID:NM_012133.1-1090s1c1
Sequence:CCGGGCCATTACTACACTCCTCAAACTCGAGTTTGAGGAGTGTAGTAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012133.1-1579s1c1
Sequence:CCGGCCAAGCATCCTTGTACTCTTACTCGAGTAAGAGTACAAGGATGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154576    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012133.1-1677s1c1
Sequence:CCGGGATGGCACTAAATGCCACATACTCGAGTATGTGGCATTTAGTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012133.1-1810s1c1
Sequence:CCGGGCTCCTGTCTTTGAACAGAAACTCGAGTTTCTGTTCAAAGACAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_012133.1-2613s1c1
Sequence:CCGGGCAGGTGACTGTCAGAAGTAACTCGAGTTACTTCTGACAGTCACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012133
VALIDATED
COPG2 MISSION shRNA Lentiviral Transduction Particles
coatomer protein complex, subunit gamma 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012133.4-381s21c1
Sequence:GTACCGGCATCTCTGAGGATGTGATAATCTCGAGATTATCACATCCTCAGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012133.4-1238s21c1
Sequence:GTACCGGTTAGTGCTCTCTGTCAGAAATCTCGAGATTTCTGACAGAGAGCACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012133.4-1564s21c1
Sequence:GTACCGGGTGAGTGCTTTGGCTAAATTTCTCGAGAAATTTAGCCAAAGCACTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012133.4-2027s21c1
Sequence:GTACCGGGATGTATCAAGCACATGTTTACTCGAGTAAACATGTGCTTGATACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012133.1-2108s1c1
Sequence:CCGGCCTATGAAGTGCTGTCTTGTACTCGAGTACAAGACAGCACTTCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012133.1-170s1c1
Sequence:CCGGCTCCAATCAATCCAAGAAGATCTCGAGATCTTCTTGGATTGATTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A3
TRC Version: 1 Clone ID:NM_012133.1-1090s1c1
Sequence:CCGGGCCATTACTACACTCCTCAAACTCGAGTTTGAGGAGTGTAGTAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012133.1-1579s1c1
Sequence:CCGGCCAAGCATCCTTGTACTCTTACTCGAGTAAGAGTACAAGGATGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154576    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012133.1-1677s1c1
Sequence:CCGGGATGGCACTAAATGCCACATACTCGAGTATGTGGCATTTAGTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012133.1-1810s1c1
Sequence:CCGGGCTCCTGTCTTTGAACAGAAACTCGAGTTTCTGTTCAAAGACAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_012133.1-2613s1c1
Sequence:CCGGGCAGGTGACTGTCAGAAGTAACTCGAGTTACTTCTGACAGTCACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017478
VALIDATED
COPG2 MISSION shRNA Bacterial Glycerol Stock
coatomer protein complex, subunit gamma 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000311917    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017478.2-2856s21c1
Sequence:CCGGGCATGAGCTTTAGAGTTTCTTCTCGAGAAGAAACTCTAAAGCTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017478.2-1034s21c1
Sequence:CCGGCCTGCAATCTGGACTTAGAAACTCGAGTTTCTAAGTCCAGATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017478.2-283s21c1
Sequence:CCGGACTCGATTGTTTCAATCTAATCTCGAGATTAGATTGAAACAATCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017478.2-828s21c1
Sequence:CCGGTGAGAGCTGCTTGCGAAATAACTCGAGTTATTTCGCAAGCAGCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017478.2-2249s21c1
Sequence:CCGGTCCGGGATTGTGACCCTAATACTCGAGTATTAGGGTCACAATCCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100685    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017478.2-2856s1c1
Sequence:CCGGGCATGAGCTTTAGAGTTTCTTCTCGAGAAGAAACTCTAAAGCTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017478.2-2149s1c1
Sequence:CCGGCCTTACAATCAGCCAGGAATACTCGAGTATTCCTGGCTGATTGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017478.2-1034s1c1
Sequence:CCGGCCTGCAATCTGGACTTAGAAACTCGAGTTTCTAAGTCCAGATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017478.2-1033s1c1
Sequence:CCGGGCCTGCAATCTGGACTTAGAACTCGAGTTCTAAGTCCAGATTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017478.2-2534s1c1
Sequence:CCGGCCCTCTATCTAGCAGGTGTATCTCGAGATACACCTGCTAGATAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017478
VALIDATED
COPG2 MISSION shRNA shRNA Plasmid DNA
coatomer protein complex, subunit gamma 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000311917    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017478.2-2856s21c1
Sequence:CCGGGCATGAGCTTTAGAGTTTCTTCTCGAGAAGAAACTCTAAAGCTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017478.2-1034s21c1
Sequence:CCGGCCTGCAATCTGGACTTAGAAACTCGAGTTTCTAAGTCCAGATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017478.2-283s21c1
Sequence:CCGGACTCGATTGTTTCAATCTAATCTCGAGATTAGATTGAAACAATCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017478.2-828s21c1
Sequence:CCGGTGAGAGCTGCTTGCGAAATAACTCGAGTTATTTCGCAAGCAGCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017478.2-2249s21c1
Sequence:CCGGTCCGGGATTGTGACCCTAATACTCGAGTATTAGGGTCACAATCCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100685    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017478.2-2856s1c1
Sequence:CCGGGCATGAGCTTTAGAGTTTCTTCTCGAGAAGAAACTCTAAAGCTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017478.2-2149s1c1
Sequence:CCGGCCTTACAATCAGCCAGGAATACTCGAGTATTCCTGGCTGATTGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017478.2-1034s1c1
Sequence:CCGGCCTGCAATCTGGACTTAGAAACTCGAGTTTCTAAGTCCAGATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017478.2-1033s1c1
Sequence:CCGGGCCTGCAATCTGGACTTAGAACTCGAGTTCTAAGTCCAGATTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017478.2-2534s1c1
Sequence:CCGGCCCTCTATCTAGCAGGTGTATCTCGAGATACACCTGCTAGATAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017478
VALIDATED
COPG2 MISSION shRNA Lentiviral Transduction Particles
coatomer protein complex, subunit gamma 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000311917    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017478.2-2856s21c1
Sequence:CCGGGCATGAGCTTTAGAGTTTCTTCTCGAGAAGAAACTCTAAAGCTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017478.2-1034s21c1
Sequence:CCGGCCTGCAATCTGGACTTAGAAACTCGAGTTTCTAAGTCCAGATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017478.2-283s21c1
Sequence:CCGGACTCGATTGTTTCAATCTAATCTCGAGATTAGATTGAAACAATCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017478.2-828s21c1
Sequence:CCGGTGAGAGCTGCTTGCGAAATAACTCGAGTTATTTCGCAAGCAGCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017478.2-2249s21c1
Sequence:CCGGTCCGGGATTGTGACCCTAATACTCGAGTATTAGGGTCACAATCCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100685    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017478.2-2856s1c1
Sequence:CCGGGCATGAGCTTTAGAGTTTCTTCTCGAGAAGAAACTCTAAAGCTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017478.2-2149s1c1
Sequence:CCGGCCTTACAATCAGCCAGGAATACTCGAGTATTCCTGGCTGATTGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017478.2-1034s1c1
Sequence:CCGGCCTGCAATCTGGACTTAGAAACTCGAGTTTCTAAGTCCAGATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017478.2-1033s1c1
Sequence:CCGGGCCTGCAATCTGGACTTAGAACTCGAGTTCTAAGTCCAGATTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017478.2-2534s1c1
Sequence:CCGGCCCTCTATCTAGCAGGTGTATCTCGAGATACACCTGCTAGATAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks