EMAIL THIS PAGE TO A FRIEND

COPRS

coordinator of PRMT5, differentiation stimulator

84 Gene Product Result for
Synonyms: C17orf79 COPR5 HSA272196 TTP1
UniProtKB ID: Q9NQ92, A6NP14, E1P656, Q96EF5, Q96P75
Gene ID:
Mouse(66423) coordinator of PRMT5, differentiation stimulator
Rat(290925) coordinator of PRMT5, differentiation stimulator
cow(506999) chromosome 19 open reading frame, human C17orf79
sheep(101116921) coordinator of PRMT5, differentiation stimulator
naked mole-rat(101697367) coordinator of PRMT5, differentiation stimulator
domestic guinea pig(100721331) coordinator of PRMT5, differentiation stimulator
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA052552 Anti-COPRS antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018405 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018405 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018405 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025556 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025556 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025556 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018405 Rosetta Predictions human pricing
XM_001075131 Rosetta Predictions rat pricing
XM_214404 Rosetta Predictions rat pricing
NM_025556 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018405 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145813 predicted 427
2 SASI_Hs01_00145814 predicted 521
3 SASI_Hs01_00145816 predicted 560
4 SASI_Hs01_00145817 predicted 536
5 SASI_Hs01_00145818 predicted 328
6 SASI_Hs01_00145819 predicted 349
7 SASI_Hs01_00145820 predicted 519
8 SASI_Hs01_00145821 predicted 474
9 SASI_Hs01_00145822 predicted 407
10 SASI_Hs02_00351905 predicted 509
11 SASI_Hs01_00145815 predicted 400
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075131 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00348579 predicted 639
2 SASI_Rn02_00348580 predicted 676
3 SASI_Rn02_00348581 predicted 582
4 SASI_Rn02_00348582 predicted 445
5 SASI_Rn02_00348583 predicted 581
6 SASI_Rn02_00348584 predicted 716
7 SASI_Rn02_00348585 predicted 537
8 SASI_Rn02_00348586 predicted 230
9 SASI_Rn02_00348587 predicted 686
10 SASI_Rn02_00348588 predicted 425
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214404 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375265 predicted 622
2 SASI_Rn02_00375266 predicted 661
3 SASI_Rn02_00375267 predicted 684
4 SASI_Rn02_00375268 predicted 571
5 SASI_Rn02_00375269 predicted 556
6 SASI_Rn02_00375270 predicted 619
7 SASI_Rn02_00375271 predicted 565
8 SASI_Rn02_00375272 predicted 695
9 SASI_Rn02_00375273 predicted 528
10 SASI_Rn02_00375274 predicted 666
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025556 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200580 predicted 371
2 SASI_Mm01_00200581 predicted 516
3 SASI_Mm02_00328512 predicted 364
4 SASI_Mm01_00200583 predicted 317
5 SASI_Mm01_00200584 predicted 506
6 SASI_Mm01_00200585 predicted 360
7 SASI_Mm01_00200586 predicted 491
8 SASI_Mm01_00200588 predicted 380
9 SASI_Mm01_00200589 predicted 552
10 SASI_Mm02_00328513 predicted 488
11 SASI_Mm01_00200582 predicted 405
12 SASI_Mm01_00200587 predicted 358
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018405
VALIDATED
COPRS MISSION shRNA Bacterial Glycerol Stock
coordinator of PRMT5, differentiation stimulator
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018405.2-533s1c1
Sequence:CCGGGATACCCTATTATTCCAAGATCTCGAGATCTTGGAATAATAGGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_018405.3-554s21c1
Sequence:CCGGCACAAGGAGACATGATCTATGCTCGAGCATAGATCATGTCTCCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_018405.3-472s21c1
Sequence:CCGGGCAGATCAAGGGAATCCATATCTCGAGATATGGATTCCCTTGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_018405.3-500s21c1
Sequence:CCGGACGACATCCAGGAGAGCATTTCTCGAGAAATGCTCTCCTGGATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_018405.3-595s21c1
Sequence:CCGGCCTCCACTGATACCCTATTATCTCGAGATAATAGGGTATCAGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282866    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_018405.3-781s21c1
Sequence:CCGGCACAGACCAGTGTTCCTTATTCTCGAGAATAAGGAACACTGGTCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018405
VALIDATED
COPRS MISSION shRNA shRNA Plasmid DNA
coordinator of PRMT5, differentiation stimulator
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018405.2-533s1c1
Sequence:CCGGGATACCCTATTATTCCAAGATCTCGAGATCTTGGAATAATAGGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_018405.3-554s21c1
Sequence:CCGGCACAAGGAGACATGATCTATGCTCGAGCATAGATCATGTCTCCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_018405.3-472s21c1
Sequence:CCGGGCAGATCAAGGGAATCCATATCTCGAGATATGGATTCCCTTGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_018405.3-500s21c1
Sequence:CCGGACGACATCCAGGAGAGCATTTCTCGAGAAATGCTCTCCTGGATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_018405.3-595s21c1
Sequence:CCGGCCTCCACTGATACCCTATTATCTCGAGATAATAGGGTATCAGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282866    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_018405.3-781s21c1
Sequence:CCGGCACAGACCAGTGTTCCTTATTCTCGAGAATAAGGAACACTGGTCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018405
VALIDATED
COPRS MISSION shRNA Lentiviral Transduction Particles
coordinator of PRMT5, differentiation stimulator
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018405.2-533s1c1
Sequence:CCGGGATACCCTATTATTCCAAGATCTCGAGATCTTGGAATAATAGGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_018405.3-554s21c1
Sequence:CCGGCACAAGGAGACATGATCTATGCTCGAGCATAGATCATGTCTCCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_018405.3-472s21c1
Sequence:CCGGGCAGATCAAGGGAATCCATATCTCGAGATATGGATTCCCTTGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_018405.3-500s21c1
Sequence:CCGGACGACATCCAGGAGAGCATTTCTCGAGAAATGCTCTCCTGGATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_018405.3-595s21c1
Sequence:CCGGCCTCCACTGATACCCTATTATCTCGAGATAATAGGGTATCAGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282866    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_018405.3-781s21c1
Sequence:CCGGCACAGACCAGTGTTCCTTATTCTCGAGAATAAGGAACACTGGTCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025556
VALIDATED
COPRS MISSION shRNA Bacterial Glycerol Stock
coordinator of PRMT5, differentiation stimulator
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200629    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025556.1-610s1c1
Sequence:CCGGCACAAGTTGTTTCCTGTGTTTCTCGAGAAACACAGGAAACAACTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193013    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025556.1-379s1c1
Sequence:CCGGGAAATCCTTACGATGCTGATGCTCGAGCATCAGCATCGTAAGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192196    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025556.1-601s1c1
Sequence:CCGGCCTCCAGATCACAAGTTGTTTCTCGAGAAACAACTTGTGATCTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025556.2-185s21c1
Sequence:CCGGAGAGCATCCCTGCTGACATTCCTCGAGGAATGTCAGCAGGGATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266891    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025556.2-620s21c1
Sequence:CCGGCCTGTGTTTCAAGTGAGATACCTCGAGGTATCTCACTTGAAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025556.2-496s21c1
Sequence:CCGGCTCATACCACACTACTCCAAGCTCGAGCTTGGAGTAGTGTGGTATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025556.2-521s21c1
Sequence:CCGGTCTTCGAAACAGGACAGTTTGCTCGAGCAAACTGTCCTGTTTCGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025556.2-447s21c1
Sequence:CCGGACCACAGGGAGACATGATATACTCGAGTATATCATGTCTCCCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025556
VALIDATED
COPRS MISSION shRNA shRNA Plasmid DNA
coordinator of PRMT5, differentiation stimulator
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200629    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025556.1-610s1c1
Sequence:CCGGCACAAGTTGTTTCCTGTGTTTCTCGAGAAACACAGGAAACAACTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193013    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025556.1-379s1c1
Sequence:CCGGGAAATCCTTACGATGCTGATGCTCGAGCATCAGCATCGTAAGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192196    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025556.1-601s1c1
Sequence:CCGGCCTCCAGATCACAAGTTGTTTCTCGAGAAACAACTTGTGATCTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025556.2-185s21c1
Sequence:CCGGAGAGCATCCCTGCTGACATTCCTCGAGGAATGTCAGCAGGGATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266891    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025556.2-620s21c1
Sequence:CCGGCCTGTGTTTCAAGTGAGATACCTCGAGGTATCTCACTTGAAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025556.2-496s21c1
Sequence:CCGGCTCATACCACACTACTCCAAGCTCGAGCTTGGAGTAGTGTGGTATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025556.2-521s21c1
Sequence:CCGGTCTTCGAAACAGGACAGTTTGCTCGAGCAAACTGTCCTGTTTCGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025556.2-447s21c1
Sequence:CCGGACCACAGGGAGACATGATATACTCGAGTATATCATGTCTCCCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025556
VALIDATED
COPRS MISSION shRNA Lentiviral Transduction Particles
coordinator of PRMT5, differentiation stimulator
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200629    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025556.1-610s1c1
Sequence:CCGGCACAAGTTGTTTCCTGTGTTTCTCGAGAAACACAGGAAACAACTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193013    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025556.1-379s1c1
Sequence:CCGGGAAATCCTTACGATGCTGATGCTCGAGCATCAGCATCGTAAGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192196    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025556.1-601s1c1
Sequence:CCGGCCTCCAGATCACAAGTTGTTTCTCGAGAAACAACTTGTGATCTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025556.2-185s21c1
Sequence:CCGGAGAGCATCCCTGCTGACATTCCTCGAGGAATGTCAGCAGGGATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266891    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025556.2-620s21c1
Sequence:CCGGCCTGTGTTTCAAGTGAGATACCTCGAGGTATCTCACTTGAAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025556.2-496s21c1
Sequence:CCGGCTCATACCACACTACTCCAAGCTCGAGCTTGGAGTAGTGTGGTATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025556.2-521s21c1
Sequence:CCGGTCTTCGAAACAGGACAGTTTGCTCGAGCAAACTGTCCTGTTTCGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025556.2-447s21c1
Sequence:CCGGACCACAGGGAGACATGATATACTCGAGTATATCATGTCTCCCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks