EMAIL THIS PAGE TO A FRIEND

COPS2

COP9 signalosome subunit 2

134 Gene Product Result for
Synonyms: ALIEN CSN2 SGN2 TRIP15
Gene ID:
Mouse(12848) COP9 (constitutive photomorphogenic) homolog, subunit 2 (Arabidopsis thaliana)
Rat(261736) COP9 signalosome subunit 2
domestic guinea pig(100714584) COP9 signalosome subunit 2
naked mole-rat(101715017) COP9 signalosome subunit 2
sheep(101109182) COP9 constitutive photomorphogenic homolog subunit 2 (Arabidopsis)
Domestic Rabbit(100356314) COP9 constitutive photomorphogenic homolog subunit 2 (Arabidopsis)
Zebrafish(415145) COP9 constitutive photomorphogenic homolog subunit 2 (Arabidopsis)
cow(101907531) COP9 constitutive photomorphogenic homolog subunit 2 (Arabidopsis)
Horse(100055653) COP9 constitutive photomorphogenic homolog subunit 2 (Arabidopsis)
domestic cat(101098232) COP9 constitutive photomorphogenic homolog subunit 2 (Arabidopsis)
chicken(430917) COP9 constitutive photomorphogenic homolog subunit 2 (Arabidopsis)
dog(478295) COP9 constitutive photomorphogenic homolog subunit 2 (Arabidopsis)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2500060 Anti-ALIEN/TRIP15/COPS2 antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB2100467 Anti-COPS2 (ab1) antibody produced in rabbit affinity isolated antibody human, rat, horse, mouse, guinea pig, rabbit
western blot pricing
SAB2100468 Anti-COPS2 (ab2) antibody produced in rabbit affinity isolated antibody zebrafish, rat, bovine, guinea pig, rabbit, horse, pig, mouse, canine, human
western blot pricing
HPA016867 Anti-COPS2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AV34189 Anti-COPS2 antibody produced in rabbit affinity isolated antibody guinea pig, rabbit, human, mouse, rat, horse
western blot pricing
AV38431 Anti-COPS2 antibody produced in rabbit IgG fraction of antiserum mouse, pig, human, canine, rabbit, bovine, zebrafish, guinea pig, horse, rat
immunohistochemistry, western blot pricing
HPA018271 Anti-COPS2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, rat, human
immunohistochemistry, western blot pricing
SAB4503620 Anti-COPS2 antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence, western blot pricing
SAB2106326 Anti-COPS2 antibody produced in rabbit affinity isolated antibody human, guinea pig, zebrafish, bovine, Drosophila, horse, mouse, canine, rabbit, Drosophila, rat, African clawed frog
ELISA, western blot pricing
HPA061071 Anti-COPS2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
SAB1402462 Monoclonal Anti-COPS2, (C-terminal) antibody produced in mouse clone 4B12, purified immunoglobulin, buffered aqueous solution rat, human, mouse
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009939 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009939 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009939 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004236 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004236 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004236 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004236 Rosetta Predictions human pricing
NM_153297 Rosetta Predictions rat pricing
NM_009939 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004236 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337162 predicted 944
2 SASI_Hs01_00202456 predicted 1261
3 SASI_Hs01_00202457 predicted 844
4 SASI_Hs02_00337163 predicted 577
5 SASI_Hs01_00202458 predicted 937
6 SASI_Hs01_00202460 predicted 790
7 SASI_Hs01_00202461 predicted 260
8 SASI_Hs02_00337164 predicted 417
9 SASI_Hs01_00202462 predicted 250
10 SASI_Hs01_00202463 predicted 1200
11 SASI_Hs01_00202459 predicted 394
12 SASI_Hs01_00202464 predicted 297
13 SASI_Hs01_00202465 predicted 501
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153297 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071488 predicted 667
2 SASI_Rn01_00071490 predicted 497
3 SASI_Rn01_00071491 predicted 833
4 SASI_Rn01_00071492 predicted 985
5 SASI_Rn01_00071493 predicted 718
6 SASI_Rn01_00071494 predicted 476
7 SASI_Rn01_00071495 predicted 878
8 SASI_Rn01_00071496 predicted 1076
9 SASI_Rn01_00071497 predicted 1334
10 SASI_Rn02_00268942 predicted 429
11 SASI_Rn01_00071489 predicted 740
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009939 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091098 predicted 1038
2 SASI_Mm02_00317493 predicted 595
3 SASI_Mm01_00091099 predicted 280
4 SASI_Mm02_00317494 predicted 356
5 SASI_Mm01_00091101 predicted 370
6 SASI_Mm01_00091104 predicted 1209
7 SASI_Mm01_00091105 predicted 1285
8 SASI_Mm01_00091106 predicted 310
9 SASI_Mm01_00091107 predicted 810
10 SASI_Mm02_00317495 predicted 908
11 SASI_Mm01_00091100 predicted 1120
12 SASI_Mm01_00091102 predicted 767
13 SASI_Mm01_00091103 predicted 726
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009939
VALIDATED
COPS2 MISSION shRNA Bacterial Glycerol Stock
COP9 signalosome subunit 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009939.2-675s21c1
Sequence:CCGGGCACTCTATGAGCAATCACTTCTCGAGAAGTGATTGCTCATAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009939.2-839s21c1
Sequence:CCGGCCCAAGACGAACCACTTGTTTCTCGAGAAACAAGTGGTTCGTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009939.2-307s21c1
Sequence:CCGGAGCAACTATTGACCTATATTCCTCGAGGAATATAGGTCAATAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295479    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009939.2-1679s21c1
Sequence:CCGGACACGCTACTGTTGGTTAAATCTCGAGATTTAACCAACAGTAGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009939.2-1286s21c1
Sequence:CCGGCCGATACACTGCGCTAGATAACTCGAGTTATCTAGCGCAGTGTATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125054    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009939.2-2145s1c1
Sequence:CCGGGCCCTTACATAGAACTTGTTTCTCGAGAAACAAGTTCTATGTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009939.2-174s1c1
Sequence:CCGGGCAGCATTAAGCAGCTTCCAACTCGAGTTGGAAGCTGCTTAATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009939.2-719s1c1
Sequence:CCGGCCCACTAATCATGGGTGTCATCTCGAGATGACACCCATGATTAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009939.2-839s1c1
Sequence:CCGGCCCAAGACGAACCACTTGTTTCTCGAGAAACAAGTGGTTCGTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009939.2-675s1c1
Sequence:CCGGGCACTCTATGAGCAATCACTTCTCGAGAAGTGATTGCTCATAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009939
VALIDATED
COPS2 MISSION shRNA shRNA Plasmid DNA
COP9 signalosome subunit 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009939.2-675s21c1
Sequence:CCGGGCACTCTATGAGCAATCACTTCTCGAGAAGTGATTGCTCATAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009939.2-839s21c1
Sequence:CCGGCCCAAGACGAACCACTTGTTTCTCGAGAAACAAGTGGTTCGTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009939.2-307s21c1
Sequence:CCGGAGCAACTATTGACCTATATTCCTCGAGGAATATAGGTCAATAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295479    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009939.2-1679s21c1
Sequence:CCGGACACGCTACTGTTGGTTAAATCTCGAGATTTAACCAACAGTAGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009939.2-1286s21c1
Sequence:CCGGCCGATACACTGCGCTAGATAACTCGAGTTATCTAGCGCAGTGTATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125054    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009939.2-2145s1c1
Sequence:CCGGGCCCTTACATAGAACTTGTTTCTCGAGAAACAAGTTCTATGTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009939.2-174s1c1
Sequence:CCGGGCAGCATTAAGCAGCTTCCAACTCGAGTTGGAAGCTGCTTAATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009939.2-719s1c1
Sequence:CCGGCCCACTAATCATGGGTGTCATCTCGAGATGACACCCATGATTAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009939.2-839s1c1
Sequence:CCGGCCCAAGACGAACCACTTGTTTCTCGAGAAACAAGTGGTTCGTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009939.2-675s1c1
Sequence:CCGGGCACTCTATGAGCAATCACTTCTCGAGAAGTGATTGCTCATAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009939
VALIDATED
COPS2 MISSION shRNA Lentiviral Transduction Particles
COP9 signalosome subunit 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009939.2-675s21c1
Sequence:CCGGGCACTCTATGAGCAATCACTTCTCGAGAAGTGATTGCTCATAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009939.2-839s21c1
Sequence:CCGGCCCAAGACGAACCACTTGTTTCTCGAGAAACAAGTGGTTCGTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009939.2-307s21c1
Sequence:CCGGAGCAACTATTGACCTATATTCCTCGAGGAATATAGGTCAATAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295479    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009939.2-1679s21c1
Sequence:CCGGACACGCTACTGTTGGTTAAATCTCGAGATTTAACCAACAGTAGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009939.2-1286s21c1
Sequence:CCGGCCGATACACTGCGCTAGATAACTCGAGTTATCTAGCGCAGTGTATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125054    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009939.2-2145s1c1
Sequence:CCGGGCCCTTACATAGAACTTGTTTCTCGAGAAACAAGTTCTATGTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009939.2-174s1c1
Sequence:CCGGGCAGCATTAAGCAGCTTCCAACTCGAGTTGGAAGCTGCTTAATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009939.2-719s1c1
Sequence:CCGGCCCACTAATCATGGGTGTCATCTCGAGATGACACCCATGATTAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009939.2-839s1c1
Sequence:CCGGCCCAAGACGAACCACTTGTTTCTCGAGAAACAAGTGGTTCGTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009939.2-675s1c1
Sequence:CCGGGCACTCTATGAGCAATCACTTCTCGAGAAGTGATTGCTCATAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004236
VALIDATED
COPS2 MISSION shRNA Bacterial Glycerol Stock
COP9 signalosome subunit 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000289963    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_004236.3-1773s21c1
Sequence:CCGGGCAGAAATTCTCTCACAAATACTCGAGTATTTGTGAGAGAATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004236.3-1171s21c1
Sequence:CCGGGCCTTACACAAGAATACATATCTCGAGATATGTATTCTTGTGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004236.3-725s21c1
Sequence:CCGGGCACTCTATGAACAGTCACTTCTCGAGAAGTGACTGTTCATAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004236.3-224s21c1
Sequence:CCGGGCGGCATTAAGCAGTTTCCAACTCGAGTTGGAAACTGCTTAATGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116052    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004236.1-1709s1c1
Sequence:CCGGGCAGAAATTCTCTCACAAATACTCGAGTATTTGTGAGAGAATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004236.1-1107s1c1
Sequence:CCGGGCCTTACACAAGAATACATATCTCGAGATATGTATTCTTGTGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004236.1-160s1c1
Sequence:CCGGGCGGCATTAAGCAGTTTCCAACTCGAGTTGGAAACTGCTTAATGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004236.1-374s1c1
Sequence:CCGGCTACTTCTAAACAGATGGATTCTCGAGAATCCATCTGTTTAGAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004236.1-661s1c1
Sequence:CCGGGCACTCTATGAACAGTCACTTCTCGAGAAGTGACTGTTCATAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004236
VALIDATED
COPS2 MISSION shRNA shRNA Plasmid DNA
COP9 signalosome subunit 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000289963    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_004236.3-1773s21c1
Sequence:CCGGGCAGAAATTCTCTCACAAATACTCGAGTATTTGTGAGAGAATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004236.3-1171s21c1
Sequence:CCGGGCCTTACACAAGAATACATATCTCGAGATATGTATTCTTGTGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004236.3-725s21c1
Sequence:CCGGGCACTCTATGAACAGTCACTTCTCGAGAAGTGACTGTTCATAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004236.3-224s21c1
Sequence:CCGGGCGGCATTAAGCAGTTTCCAACTCGAGTTGGAAACTGCTTAATGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116052    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004236.1-1709s1c1
Sequence:CCGGGCAGAAATTCTCTCACAAATACTCGAGTATTTGTGAGAGAATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004236.1-1107s1c1
Sequence:CCGGGCCTTACACAAGAATACATATCTCGAGATATGTATTCTTGTGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004236.1-160s1c1
Sequence:CCGGGCGGCATTAAGCAGTTTCCAACTCGAGTTGGAAACTGCTTAATGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004236.1-374s1c1
Sequence:CCGGCTACTTCTAAACAGATGGATTCTCGAGAATCCATCTGTTTAGAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004236.1-661s1c1
Sequence:CCGGGCACTCTATGAACAGTCACTTCTCGAGAAGTGACTGTTCATAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004236
VALIDATED
COPS2 MISSION shRNA Lentiviral Transduction Particles
COP9 signalosome subunit 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000289963    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_004236.3-1773s21c1
Sequence:CCGGGCAGAAATTCTCTCACAAATACTCGAGTATTTGTGAGAGAATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004236.3-1171s21c1
Sequence:CCGGGCCTTACACAAGAATACATATCTCGAGATATGTATTCTTGTGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004236.3-725s21c1
Sequence:CCGGGCACTCTATGAACAGTCACTTCTCGAGAAGTGACTGTTCATAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004236.3-224s21c1
Sequence:CCGGGCGGCATTAAGCAGTTTCCAACTCGAGTTGGAAACTGCTTAATGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116052    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004236.1-1709s1c1
Sequence:CCGGGCAGAAATTCTCTCACAAATACTCGAGTATTTGTGAGAGAATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004236.1-1107s1c1
Sequence:CCGGGCCTTACACAAGAATACATATCTCGAGATATGTATTCTTGTGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004236.1-160s1c1
Sequence:CCGGGCGGCATTAAGCAGTTTCCAACTCGAGTTGGAAACTGCTTAATGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004236.1-374s1c1
Sequence:CCGGCTACTTCTAAACAGATGGATTCTCGAGAATCCATCTGTTTAGAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004236.1-661s1c1
Sequence:CCGGGCACTCTATGAACAGTCACTTCTCGAGAAGTGACTGTTCATAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks