EMAIL THIS PAGE TO A FRIEND

COPS3

COP9 signalosome subunit 3

70 Gene Product Result for
Synonyms: CSN3 SGN3
UniProtKB ID: Q9UNS2, B2R683, B4DY81, O43191, Q7LDR6
Gene ID:
Human(8533) Summary: The protein encoded by this gene possesses kinase activity that phosphorylates regulators involved in signal transduction. It phosphorylates I kappa-Balpha, p105, and c-Jun. It acts as a docking site for complex-mediated phosphorylation. The gene is located within the Smith-Magenis syndrome region on chromosome 17. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
Mouse(26572) COP9 (constitutive photomorphogenic) homolog, subunit 3 (Arabidopsis thaliana)
Rat(287367) COP9 signalosome subunit 3
Zebrafish(335720) COP9 constitutive photomorphogenic homolog subunit 3
cow(507932) COP9 constitutive photomorphogenic homolog subunit 3 (Arabidopsis)
Horse(100051092) COP9 constitutive photomorphogenic homolog subunit 3 (Arabidopsis)
domestic cat(101081265) COP9 constitutive photomorphogenic homolog subunit 3 (Arabidopsis)
dog(479528) COP9 constitutive photomorphogenic homolog subunit 3 (Arabidopsis)
chicken(416504) COP9 constitutive photomorphogenic homolog subunit 3 (Arabidopsis)
sheep(101121690) COP9 constitutive photomorphogenic homolog subunit 3 (Arabidopsis)
naked mole-rat(101709376) COP9 signalosome subunit 3
domestic guinea pig(100730261) COP9 signalosome subunit 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011991 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011991 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011991 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003653 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003653 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003653 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU016431 MISSION® esiRNA esiRNA targeting human COPS3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003653 Rosetta Predictions human pricing
NM_001004200 Rosetta Predictions rat pricing
NM_011991 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003653 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224945 predicted 453
2 SASI_Hs02_00336028 predicted 1329
3 SASI_Hs01_00224946 predicted 746
4 SASI_Hs01_00224947 predicted 934
5 SASI_Hs01_00224948 predicted 576
6 SASI_Hs01_00224950 predicted 604
7 SASI_Hs01_00224951 predicted 844
8 SASI_Hs01_00224952 predicted 308
9 SASI_Hs01_00224953 predicted 874
10 SASI_Hs01_00224954 predicted 1280
11 SASI_Hs01_00224949 predicted 455
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004200 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030424 predicted 760
2 SASI_Rn01_00030425 predicted 408
3 SASI_Rn01_00030426 predicted 632
4 SASI_Rn01_00030427 predicted 530
5 SASI_Rn01_00030428 predicted 730
6 SASI_Rn01_00030429 predicted 330
7 SASI_Rn01_00030430 predicted 1042
8 SASI_Rn01_00030431 predicted 787
9 SASI_Rn01_00030432 predicted 402
10 SASI_Rn01_00030433 predicted 687
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011991 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103164 predicted 422
2 SASI_Mm01_00103165 predicted 401
3 SASI_Mm01_00103166 predicted 529
4 SASI_Mm01_00103167 predicted 690
5 SASI_Mm01_00103169 predicted 762
6 SASI_Mm01_00103170 predicted 810
7 SASI_Mm01_00103171 predicted 817
8 SASI_Mm01_00103172 predicted 688
9 SASI_Mm01_00103173 predicted 394
10 SASI_Mm02_00321917 predicted 790
11 SASI_Mm01_00103168 predicted 744
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011991
VALIDATED
COPS3 MISSION shRNA Bacterial Glycerol Stock
COP9 signalosome subunit 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124589    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011991.1-1404s1c1
Sequence:CCGGCCTCCTGGACAGTCAGAAATTCTCGAGAATTTCTGACTGTCCAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011991.1-312s1c1
Sequence:CCGGGCGAGCACATTCGATATGCAACTCGAGTTGCATATCGAATGTGCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011991.1-764s1c1
Sequence:CCGGCTGCCTAAATACACCTCTCAACTCGAGTTGAGAGGTGTATTTAGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011991.1-1088s1c1
Sequence:CCGGGCAAGTATTAACCAGAAGGATCTCGAGATCCTTCTGGTTAATACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011991.1-777s1c1
Sequence:CCGGCCTCTCAAATAGTGGGTAGATCTCGAGATCTACCCACTATTTGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011991.1-309s21c1
Sequence:CCGGATGGCGAGCACATTCGATATGCTCGAGCATATCGAATGTGCTCGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011991.1-823s21c1
Sequence:CCGGCCATGAGTTAGCACAAGTTTACTCGAGTAAACTTGTGCTAACTCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011991.1-600s21c1
Sequence:CCGGATTATGGAGGAATGATCTATACTCGAGTATAGATCATTCCTCCATAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011991.1-350s21c1
Sequence:CCGGCTTTGCCATCAGCTAACAAATCTCGAGATTTGTTAGCTGATGGCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317237    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011991.1-1404s21c1
Sequence:CCGGCCTCCTGGACAGTCAGAAATTCTCGAGAATTTCTGACTGTCCAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011991
VALIDATED
COPS3 MISSION shRNA shRNA Plasmid DNA
COP9 signalosome subunit 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124589    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011991.1-1404s1c1
Sequence:CCGGCCTCCTGGACAGTCAGAAATTCTCGAGAATTTCTGACTGTCCAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011991.1-312s1c1
Sequence:CCGGGCGAGCACATTCGATATGCAACTCGAGTTGCATATCGAATGTGCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011991.1-764s1c1
Sequence:CCGGCTGCCTAAATACACCTCTCAACTCGAGTTGAGAGGTGTATTTAGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011991.1-1088s1c1
Sequence:CCGGGCAAGTATTAACCAGAAGGATCTCGAGATCCTTCTGGTTAATACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011991.1-777s1c1
Sequence:CCGGCCTCTCAAATAGTGGGTAGATCTCGAGATCTACCCACTATTTGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011991.1-309s21c1
Sequence:CCGGATGGCGAGCACATTCGATATGCTCGAGCATATCGAATGTGCTCGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011991.1-823s21c1
Sequence:CCGGCCATGAGTTAGCACAAGTTTACTCGAGTAAACTTGTGCTAACTCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011991.1-600s21c1
Sequence:CCGGATTATGGAGGAATGATCTATACTCGAGTATAGATCATTCCTCCATAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011991.1-350s21c1
Sequence:CCGGCTTTGCCATCAGCTAACAAATCTCGAGATTTGTTAGCTGATGGCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317237    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011991.1-1404s21c1
Sequence:CCGGCCTCCTGGACAGTCAGAAATTCTCGAGAATTTCTGACTGTCCAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011991
VALIDATED
COPS3 MISSION shRNA Lentiviral Transduction Particles
COP9 signalosome subunit 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124589    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011991.1-1404s1c1
Sequence:CCGGCCTCCTGGACAGTCAGAAATTCTCGAGAATTTCTGACTGTCCAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011991.1-312s1c1
Sequence:CCGGGCGAGCACATTCGATATGCAACTCGAGTTGCATATCGAATGTGCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011991.1-764s1c1
Sequence:CCGGCTGCCTAAATACACCTCTCAACTCGAGTTGAGAGGTGTATTTAGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011991.1-1088s1c1
Sequence:CCGGGCAAGTATTAACCAGAAGGATCTCGAGATCCTTCTGGTTAATACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011991.1-777s1c1
Sequence:CCGGCCTCTCAAATAGTGGGTAGATCTCGAGATCTACCCACTATTTGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011991.1-309s21c1
Sequence:CCGGATGGCGAGCACATTCGATATGCTCGAGCATATCGAATGTGCTCGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011991.1-823s21c1
Sequence:CCGGCCATGAGTTAGCACAAGTTTACTCGAGTAAACTTGTGCTAACTCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011991.1-600s21c1
Sequence:CCGGATTATGGAGGAATGATCTATACTCGAGTATAGATCATTCCTCCATAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011991.1-350s21c1
Sequence:CCGGCTTTGCCATCAGCTAACAAATCTCGAGATTTGTTAGCTGATGGCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317237    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011991.1-1404s21c1
Sequence:CCGGCCTCCTGGACAGTCAGAAATTCTCGAGAATTTCTGACTGTCCAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003653
VALIDATED
COPS3 MISSION shRNA Bacterial Glycerol Stock
COP9 signalosome subunit 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003653.2-528s1c1
Sequence:CCGGGCCAGCTTTGTTTGCTAGCAACTCGAGTTGCTAGCAAACAAAGCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003653.2-1202s1c1
Sequence:CCGGGCCATGCTTCATAACATTGATCTCGAGATCAATGTTATGAAGCATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151093    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003653.2-1382s1c1
Sequence:CCGGGCTAAACAAGAGAAACTACCACTCGAGTGGTAGTTTCTCTTGTTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003653.2-979s1c1
Sequence:CCGGGCAATGCTTGTCATCTCTTTACTCGAGTAAAGAGATGACAAGCATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003653.2-798s1c1
Sequence:CCGGGCAAAGTACAACAGCTACCAACTCGAGTTGGTAGCTGTTGTACTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003653.2-314s1c1
Sequence:CCGGGAAACGCTATTCTCACAGGTTCTCGAGAACCTGTGAGAATAGCGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003653.2-194s1c1
Sequence:CCGGCTTGCGAAGAACTTATCCCATCTCGAGATGGGATAAGTTCTTCGCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003653.2-528s21c1
Sequence:CCGGGCCAGCTTTGTTTGCTAGCAACTCGAGTTGCTAGCAAACAAAGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003653.2-1202s21c1
Sequence:CCGGGCCATGCTTCATAACATTGATCTCGAGATCAATGTTATGAAGCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003653.2-979s21c1
Sequence:CCGGGCAATGCTTGTCATCTCTTTACTCGAGTAAAGAGATGACAAGCATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338899    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003653.2-1382s21c1
Sequence:CCGGGCTAAACAAGAGAAACTACCACTCGAGTGGTAGTTTCTCTTGTTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003653
VALIDATED
COPS3 MISSION shRNA shRNA Plasmid DNA
COP9 signalosome subunit 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003653.2-528s1c1
Sequence:CCGGGCCAGCTTTGTTTGCTAGCAACTCGAGTTGCTAGCAAACAAAGCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003653.2-1202s1c1
Sequence:CCGGGCCATGCTTCATAACATTGATCTCGAGATCAATGTTATGAAGCATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151093    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003653.2-1382s1c1
Sequence:CCGGGCTAAACAAGAGAAACTACCACTCGAGTGGTAGTTTCTCTTGTTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003653.2-979s1c1
Sequence:CCGGGCAATGCTTGTCATCTCTTTACTCGAGTAAAGAGATGACAAGCATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003653.2-798s1c1
Sequence:CCGGGCAAAGTACAACAGCTACCAACTCGAGTTGGTAGCTGTTGTACTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003653.2-314s1c1
Sequence:CCGGGAAACGCTATTCTCACAGGTTCTCGAGAACCTGTGAGAATAGCGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003653.2-194s1c1
Sequence:CCGGCTTGCGAAGAACTTATCCCATCTCGAGATGGGATAAGTTCTTCGCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003653.2-528s21c1
Sequence:CCGGGCCAGCTTTGTTTGCTAGCAACTCGAGTTGCTAGCAAACAAAGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003653.2-1202s21c1
Sequence:CCGGGCCATGCTTCATAACATTGATCTCGAGATCAATGTTATGAAGCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003653.2-979s21c1
Sequence:CCGGGCAATGCTTGTCATCTCTTTACTCGAGTAAAGAGATGACAAGCATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338899    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003653.2-1382s21c1
Sequence:CCGGGCTAAACAAGAGAAACTACCACTCGAGTGGTAGTTTCTCTTGTTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003653
VALIDATED
COPS3 MISSION shRNA Lentiviral Transduction Particles
COP9 signalosome subunit 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003653.2-528s1c1
Sequence:CCGGGCCAGCTTTGTTTGCTAGCAACTCGAGTTGCTAGCAAACAAAGCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003653.2-1202s1c1
Sequence:CCGGGCCATGCTTCATAACATTGATCTCGAGATCAATGTTATGAAGCATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151093    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003653.2-1382s1c1
Sequence:CCGGGCTAAACAAGAGAAACTACCACTCGAGTGGTAGTTTCTCTTGTTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003653.2-979s1c1
Sequence:CCGGGCAATGCTTGTCATCTCTTTACTCGAGTAAAGAGATGACAAGCATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003653.2-798s1c1
Sequence:CCGGGCAAAGTACAACAGCTACCAACTCGAGTTGGTAGCTGTTGTACTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003653.2-314s1c1
Sequence:CCGGGAAACGCTATTCTCACAGGTTCTCGAGAACCTGTGAGAATAGCGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003653.2-194s1c1
Sequence:CCGGCTTGCGAAGAACTTATCCCATCTCGAGATGGGATAAGTTCTTCGCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003653.2-528s21c1
Sequence:CCGGGCCAGCTTTGTTTGCTAGCAACTCGAGTTGCTAGCAAACAAAGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003653.2-1202s21c1
Sequence:CCGGGCCATGCTTCATAACATTGATCTCGAGATCAATGTTATGAAGCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003653.2-979s21c1
Sequence:CCGGGCAATGCTTGTCATCTCTTTACTCGAGTAAAGAGATGACAAGCATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338899    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003653.2-1382s21c1
Sequence:CCGGGCTAAACAAGAGAAACTACCACTCGAGTGGTAGTTTCTCTTGTTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)