EMAIL THIS PAGE TO A FRIEND

COPS4

COP9 signalosome subunit 4

111 Gene Product Result for
Synonyms: CSN4
UniProtKB ID: Q9BT78, B3KN88, B3KST5, Q561W7, Q9NW31, Q9Y677
Gene ID:
Human(51138) Summary: This gene encodes one of eight subunits composing COP9 signalosome, a highly conserved protein complex that functions as an important regulator in multiple signaling pathways. The structure and function of COP9 signalosome is similar to that of the 19S regulatory particle of 26S proteasome. COP9 signalosome has been shown to interact with SCF-type E3 ubiquitin ligases and act as a positive regulator of E3 ubiquitin ligases. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Mouse(26891) COP9 (constitutive photomorphogenic) homolog, subunit 4 (Arabidopsis thaliana)
Rat(360915) COP9 signalosome subunit 4
domestic guinea pig(100722440) COP9 signalosome subunit 4
naked mole-rat(101719262) COP9 signalosome subunit 4
sheep(101117334) COP9 constitutive photomorphogenic homolog subunit 4 (Arabidopsis)
Zebrafish(325592) COP9 constitutive photomorphogenic homolog subunit 4 (Arabidopsis)
cow(540223) COP9 constitutive photomorphogenic homolog subunit 4 (Arabidopsis)
Horse(100052196) COP9 constitutive photomorphogenic homolog subunit 4 (Arabidopsis)
domestic cat(101085203) COP9 constitutive photomorphogenic homolog subunit 4 (Arabidopsis)
dog(478455) COP9 constitutive photomorphogenic homolog subunit 4 (Arabidopsis)
chicken(422594) COP9 constitutive photomorphogenic homolog subunit 4 (Arabidopsis)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012001 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_012001 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_012001 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016129 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016129 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016129 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016129 Rosetta Predictions human pricing
NM_001004275 Rosetta Predictions rat pricing
NM_012001 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016129 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183200 predicted 1154
2 SASI_Hs02_00348921 predicted 792
3 SASI_Hs01_00183202 predicted 251
4 SASI_Hs02_00348922 predicted 890
5 SASI_Hs01_00183203 predicted 1000
6 SASI_Hs01_00183204 predicted 1043
7 SASI_Hs01_00183205 predicted 682
8 SASI_Hs01_00183208 predicted 827
9 SASI_Hs02_00348923 predicted 559
10 SASI_Hs01_00183209 predicted 975
11 SASI_Hs01_00183201 predicted 285
12 SASI_Hs01_00183206 predicted 268
13 SASI_Hs01_00183207 predicted 392
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004275 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060301 predicted 476
2 SASI_Rn02_00198309 predicted 806
3 SASI_Rn01_00060305 predicted 880
4 SASI_Rn01_00060306 predicted 446
5 SASI_Rn01_00060307 predicted 581
6 SASI_Rn02_00198310 predicted 879
7 SASI_Rn02_00198311 predicted 706
8 SASI_Rn01_00060308 predicted 872
9 SASI_Rn01_00060309 predicted 532
10 SASI_Rn02_00198312 predicted 570
11 SASI_Rn01_00060300 predicted 1289
12 SASI_Rn01_00060302 predicted 1336
13 SASI_Rn01_00060303 predicted 1327
14 SASI_Rn01_00060304 predicted 944
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012001 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173805 predicted 579
2 SASI_Mm01_00173806 predicted 1052
3 SASI_Mm02_00321940 predicted 826
4 SASI_Mm02_00321941 predicted 563
5 SASI_Mm01_00173808 predicted 939
6 SASI_Mm01_00173809 predicted 572
7 SASI_Mm01_00173810 predicted 447
8 SASI_Mm01_00173811 predicted 876
9 SASI_Mm01_00173813 predicted 693
10 SASI_Mm01_00173814 predicted 486
11 SASI_Mm01_00173807 predicted 479
12 SASI_Mm01_00173812 predicted 404
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012001
VALIDATED
COPS4 MISSION shRNA Bacterial Glycerol Stock
COP9 signalosome subunit 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000363545    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012001.1-1315s21c1
Sequence:CCGGCCCTCAAAGCATTTGCATCATCTCGAGATGATGCAAATGCTTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012001.2-1074s21c1
Sequence:CCGGAGCTGTTATTGAGCATAATTTCTCGAGAAATTATGCTCAATAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012001.1-309s21c1
Sequence:CCGGAGATCCAGCCTCGGGTCATTTCTCGAGAAATGACCCGAGGCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012001.1-1153s21c1
Sequence:CCGGGCAGATCCAGTCACTTTGTTTCTCGAGAAACAAAGTGACTGGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012001.1-1099s21c1
Sequence:CCGGGATCGATGGAATAGTTCATTTCTCGAGAAATGAACTATTCCATCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012001.1-612s1c1
Sequence:CCGGCGCGTGTCCTTGATTACAGAACTCGAGTTCTGTAATCAAGGACACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012001.1-1315s1c1
Sequence:CCGGCCCTCAAAGCATTTGCATCATCTCGAGATGATGCAAATGCTTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012001.1-104s1c1
Sequence:CCGGGCGGGCAAATATCGTCAGATTCTCGAGAATCTGACGATATTTGCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012001.1-1153s1c1
Sequence:CCGGGCAGATCCAGTCACTTTGTTTCTCGAGAAACAAAGTGACTGGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012001.1-619s1c1
Sequence:CCGGCCTTGATTACAGAAGGAAATTCTCGAGAATTTCCTTCTGTAATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012001
VALIDATED
COPS4 MISSION shRNA shRNA Plasmid DNA
COP9 signalosome subunit 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000363545    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012001.1-1315s21c1
Sequence:CCGGCCCTCAAAGCATTTGCATCATCTCGAGATGATGCAAATGCTTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012001.2-1074s21c1
Sequence:CCGGAGCTGTTATTGAGCATAATTTCTCGAGAAATTATGCTCAATAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012001.1-309s21c1
Sequence:CCGGAGATCCAGCCTCGGGTCATTTCTCGAGAAATGACCCGAGGCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012001.1-1153s21c1
Sequence:CCGGGCAGATCCAGTCACTTTGTTTCTCGAGAAACAAAGTGACTGGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012001.1-1099s21c1
Sequence:CCGGGATCGATGGAATAGTTCATTTCTCGAGAAATGAACTATTCCATCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012001.1-612s1c1
Sequence:CCGGCGCGTGTCCTTGATTACAGAACTCGAGTTCTGTAATCAAGGACACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012001.1-1315s1c1
Sequence:CCGGCCCTCAAAGCATTTGCATCATCTCGAGATGATGCAAATGCTTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012001.1-104s1c1
Sequence:CCGGGCGGGCAAATATCGTCAGATTCTCGAGAATCTGACGATATTTGCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012001.1-1153s1c1
Sequence:CCGGGCAGATCCAGTCACTTTGTTTCTCGAGAAACAAAGTGACTGGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012001.1-619s1c1
Sequence:CCGGCCTTGATTACAGAAGGAAATTCTCGAGAATTTCCTTCTGTAATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012001
VALIDATED
COPS4 MISSION shRNA Lentiviral Transduction Particles
COP9 signalosome subunit 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000363545    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012001.1-1315s21c1
Sequence:CCGGCCCTCAAAGCATTTGCATCATCTCGAGATGATGCAAATGCTTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012001.2-1074s21c1
Sequence:CCGGAGCTGTTATTGAGCATAATTTCTCGAGAAATTATGCTCAATAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012001.1-309s21c1
Sequence:CCGGAGATCCAGCCTCGGGTCATTTCTCGAGAAATGACCCGAGGCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012001.1-1153s21c1
Sequence:CCGGGCAGATCCAGTCACTTTGTTTCTCGAGAAACAAAGTGACTGGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012001.1-1099s21c1
Sequence:CCGGGATCGATGGAATAGTTCATTTCTCGAGAAATGAACTATTCCATCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012001.1-612s1c1
Sequence:CCGGCGCGTGTCCTTGATTACAGAACTCGAGTTCTGTAATCAAGGACACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012001.1-1315s1c1
Sequence:CCGGCCCTCAAAGCATTTGCATCATCTCGAGATGATGCAAATGCTTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012001.1-104s1c1
Sequence:CCGGGCGGGCAAATATCGTCAGATTCTCGAGAATCTGACGATATTTGCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012001.1-1153s1c1
Sequence:CCGGGCAGATCCAGTCACTTTGTTTCTCGAGAAACAAAGTGACTGGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012001.1-619s1c1
Sequence:CCGGCCTTGATTACAGAAGGAAATTCTCGAGAATTTCCTTCTGTAATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016129
VALIDATED
COPS4 MISSION shRNA Bacterial Glycerol Stock
COP9 signalosome subunit 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000288734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016129.2-1245s21c1
Sequence:CCGGCGTGGGATAAGCAGATCCAATCTCGAGATTGGATCTGCTTATCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016129.2-960s21c1
Sequence:CCGGGAGGAAATCAACTTCAAGAATCTCGAGATTCTTGAAGTTGATTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016129.2-1468s21c1
Sequence:CCGGTATGCTGGATTCCGTTTAAAGCTCGAGCTTTAAACGGAATCCAGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016129.2-585s21c1
Sequence:CCGGTGAAGATTGCTAGGCTATATCCTCGAGGATATAGCCTAGCAATCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016129.2-1201s21c1
Sequence:CCGGGATTGATGGAATAGTTCATTTCTCGAGAAATGAACTATTCCATCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016129.2-449s1c1
Sequence:CCGGGCTTCCATAAGACAGCATCTTCTCGAGAAGATGCTGTCTTATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016129.2-647s1c1
Sequence:CCGGCGAGCATCGTTGCTTCAGAATCTCGAGATTCTGAAGCAACGATGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016129.2-1245s1c1
Sequence:CCGGCGTGGGATAAGCAGATCCAATCTCGAGATTGGATCTGCTTATCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016129.2-960s1c1
Sequence:CCGGGAGGAAATCAACTTCAAGAATCTCGAGATTCTTGAAGTTGATTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118342    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016129.2-1603s1c1
Sequence:CCGGAGGTGAAATATCTGTGGCTAACTCGAGTTAGCCACAGATATTTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016129
VALIDATED
COPS4 MISSION shRNA shRNA Plasmid DNA
COP9 signalosome subunit 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000288734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016129.2-1245s21c1
Sequence:CCGGCGTGGGATAAGCAGATCCAATCTCGAGATTGGATCTGCTTATCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016129.2-960s21c1
Sequence:CCGGGAGGAAATCAACTTCAAGAATCTCGAGATTCTTGAAGTTGATTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016129.2-1468s21c1
Sequence:CCGGTATGCTGGATTCCGTTTAAAGCTCGAGCTTTAAACGGAATCCAGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016129.2-585s21c1
Sequence:CCGGTGAAGATTGCTAGGCTATATCCTCGAGGATATAGCCTAGCAATCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016129.2-1201s21c1
Sequence:CCGGGATTGATGGAATAGTTCATTTCTCGAGAAATGAACTATTCCATCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016129.2-449s1c1
Sequence:CCGGGCTTCCATAAGACAGCATCTTCTCGAGAAGATGCTGTCTTATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016129.2-647s1c1
Sequence:CCGGCGAGCATCGTTGCTTCAGAATCTCGAGATTCTGAAGCAACGATGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016129.2-1245s1c1
Sequence:CCGGCGTGGGATAAGCAGATCCAATCTCGAGATTGGATCTGCTTATCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016129.2-960s1c1
Sequence:CCGGGAGGAAATCAACTTCAAGAATCTCGAGATTCTTGAAGTTGATTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118342    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016129.2-1603s1c1
Sequence:CCGGAGGTGAAATATCTGTGGCTAACTCGAGTTAGCCACAGATATTTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016129
VALIDATED
COPS4 MISSION shRNA Lentiviral Transduction Particles
COP9 signalosome subunit 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000288734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016129.2-1245s21c1
Sequence:CCGGCGTGGGATAAGCAGATCCAATCTCGAGATTGGATCTGCTTATCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016129.2-960s21c1
Sequence:CCGGGAGGAAATCAACTTCAAGAATCTCGAGATTCTTGAAGTTGATTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016129.2-1468s21c1
Sequence:CCGGTATGCTGGATTCCGTTTAAAGCTCGAGCTTTAAACGGAATCCAGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016129.2-585s21c1
Sequence:CCGGTGAAGATTGCTAGGCTATATCCTCGAGGATATAGCCTAGCAATCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016129.2-1201s21c1
Sequence:CCGGGATTGATGGAATAGTTCATTTCTCGAGAAATGAACTATTCCATCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016129.2-449s1c1
Sequence:CCGGGCTTCCATAAGACAGCATCTTCTCGAGAAGATGCTGTCTTATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016129.2-647s1c1
Sequence:CCGGCGAGCATCGTTGCTTCAGAATCTCGAGATTCTGAAGCAACGATGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016129.2-1245s1c1
Sequence:CCGGCGTGGGATAAGCAGATCCAATCTCGAGATTGGATCTGCTTATCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016129.2-960s1c1
Sequence:CCGGGAGGAAATCAACTTCAAGAATCTCGAGATTCTTGAAGTTGATTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118342    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016129.2-1603s1c1
Sequence:CCGGAGGTGAAATATCTGTGGCTAACTCGAGTTAGCCACAGATATTTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks