EMAIL THIS PAGE TO A FRIEND

COPS5

COP9 signalosome subunit 5

68 Gene Product Result for
Synonyms: CSN5 JAB1 MOV-34 SGN5
UniProtKB ID: Q92905, O15386, Q6AW95, Q86WQ4, Q9BQ17
Gene ID:
Human(10987) Summary: The protein encoded by this gene is one of the eight subunits of COP9 signalosome, a highly conserved protein complex that functions as an important regulator in multiple signaling pathways. The structure and function of COP9 signalosome is similar to that of the 19S regulatory particle of 26S proteasome. COP9 signalosome has been shown to interact with SCF-type E3 ubiquitin ligases and act as a positive regulator of E3 ubiquitin ligases. This protein is reported to be involved in the degradation of cyclin-dependent kinase inhibitor CDKN1B/p27Kip1. It is also known to be an coactivator that increases the specificity of JUN/AP1 transcription factors. [provided by RefSeq, Jul 2008]
Mouse(26754) COP9 (constitutive photomorphogenic) homolog, subunit 5 (Arabidopsis thaliana)
Rat(312916) COP9 signalosome subunit 5
Zebrafish(393698) COP9 constitutive photomorphogenic homolog subunit 5
chicken(426579) COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis)
cow(507179) COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis)
Horse(100051846) COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis)
domestic cat(101092084) COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis)
dog(477901) COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis)
sheep(101101995) COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis)
naked mole-rat(101710038) COP9 signalosome subunit 5
domestic guinea pig(100716886) COP9 signalosome subunit 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2701900 Anti-cops5 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
HPA004845 Anti-COPS5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
AV32834 Anti-COPS5 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB2100469 Anti-COPS5 antibody produced in rabbit affinity isolated antibody mouse, human, rabbit, horse, zebrafish, canine, pig, rat, guinea pig
western blot pricing
SAB4500187 Anti-COPS5 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, western blot pricing
HPA051531 Anti-COPS5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
J3395 Anti-JAB1 (SV-16) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution rat, mouse, human
immunohistochemistry, immunoprecipitation, microarray, western blot pricing
J3020 Anti-JAB1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse, rat
immunohistochemistry, immunoprecipitation, microarray, western blot pricing
SAB4100451 Monoclonal Anti-COPS5 antibody produced in mouse clone COPS5-A388, culture supernatant human
western blot pricing
SAB2702152 Monoclonal Anti-COPS5 antibody produced in mouse human, mouse, Drosophila, rat
immunocytochemistry, immunofluorescence, immunohistochemistry, immunoprecipitation, western blot pricing
SAB2702153 Monoclonal Anti-COPS5 antibody produced in mouse Drosophila, human, mouse
immunoprecipitation, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013715 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013715 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013715 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006837 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006837 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006837 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU084671 MISSION® esiRNA esiRNA human COPS5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006837 Rosetta Predictions human pricing
NM_001025695 Rosetta Predictions rat pricing
NM_013715 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006837 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342404 predicted 812
2 SASI_Hs01_00209042 predicted 863
3 SASI_Hs01_00209043 predicted 1256
4 SASI_Hs01_00209044 predicted 1230
5 SASI_Hs01_00209045 predicted 1048
6 SASI_Hs01_00209046 predicted 899
7 SASI_Hs01_00209047 predicted 474
8 SASI_Hs01_00209048 predicted 462
9 SASI_Hs01_00209049 predicted 998
10 SASI_Hs02_00342405 predicted 388
11 SASI_Hs01_00209040 predicted 1178
12 SASI_Hs01_00209041 predicted 831
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025695 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114189 predicted 453
2 SASI_Rn01_00114190 predicted 962
3 SASI_Rn01_00114191 predicted 576
4 SASI_Rn02_00203314 predicted 619
5 SASI_Rn01_00114192 predicted 686
6 SASI_Rn01_00114193 predicted 655
7 SASI_Rn01_00114194 predicted 910
8 SASI_Rn01_00114195 predicted 267
9 SASI_Rn01_00114196 predicted 251
10 SASI_Rn01_00114197 predicted 676
11 SASI_Rn01_00114198 predicted 853
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013715 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083315 predicted 441
2 SASI_Mm01_00083316 predicted 945
3 SASI_Mm01_00083317 predicted 404
4 SASI_Mm01_00083318 predicted 831
5 SASI_Mm01_00083319 predicted 970
6 SASI_Mm01_00083320 predicted 492
7 SASI_Mm01_00083321 predicted 675
8 SASI_Mm01_00083322 predicted 1002
9 SASI_Mm01_00083323 predicted 267
10 SASI_Mm02_00322624 predicted 599
11 SASI_Mm01_00083324 predicted 230
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013715
VALIDATED
COPS5 MISSION shRNA Bacterial Glycerol Stock
COP9 signalosome subunit 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013715.1-486s1c1
Sequence:CCGGGCCTTGAGAATGCAATCGGTTCTCGAGAACCGATTGCATTCTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013715.1-652s1c1
Sequence:CCGGCGCCTTTAGGACATATCCAAACTCGAGTTTGGATATGTCCTAAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013715.1-438s1c1
Sequence:CCGGCGTATGAGTATATGGCTGCATCTCGAGATGCAGCCATATACTCATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013715.1-574s1c1
Sequence:CCGGCCAGCAGTTTCAAGAACCATTCTCGAGAATGGTTCTTGAAACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013715.1-1007s1c1
Sequence:CCGGGCTACTAGAGACAGCTGTAAACTCGAGTTTACAGCTGTCTCTAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013715.1-574s21c1
Sequence:CCGGCCAGCAGTTTCAAGAACCATTCTCGAGAATGGTTCTTGAAACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013715.1-163s21c1
Sequence:CCGGAGCGCAGAGTATCGATGAAATCTCGAGATTTCATCGATACTCTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013715.1-438s21c1
Sequence:CCGGCGTATGAGTATATGGCTGCATCTCGAGATGCAGCCATATACTCATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013715.1-1007s21c1
Sequence:CCGGGCTACTAGAGACAGCTGTAAACTCGAGTTTACAGCTGTCTCTAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013715.1-1050s21c1
Sequence:CCGGGACTGATGTCTCAGGTTATTACTCGAGTAATAACCTGAGACATCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013715
VALIDATED
COPS5 MISSION shRNA shRNA Plasmid DNA
COP9 signalosome subunit 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013715.1-486s1c1
Sequence:CCGGGCCTTGAGAATGCAATCGGTTCTCGAGAACCGATTGCATTCTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013715.1-652s1c1
Sequence:CCGGCGCCTTTAGGACATATCCAAACTCGAGTTTGGATATGTCCTAAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013715.1-438s1c1
Sequence:CCGGCGTATGAGTATATGGCTGCATCTCGAGATGCAGCCATATACTCATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013715.1-574s1c1
Sequence:CCGGCCAGCAGTTTCAAGAACCATTCTCGAGAATGGTTCTTGAAACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013715.1-1007s1c1
Sequence:CCGGGCTACTAGAGACAGCTGTAAACTCGAGTTTACAGCTGTCTCTAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013715.1-574s21c1
Sequence:CCGGCCAGCAGTTTCAAGAACCATTCTCGAGAATGGTTCTTGAAACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013715.1-163s21c1
Sequence:CCGGAGCGCAGAGTATCGATGAAATCTCGAGATTTCATCGATACTCTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013715.1-438s21c1
Sequence:CCGGCGTATGAGTATATGGCTGCATCTCGAGATGCAGCCATATACTCATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013715.1-1007s21c1
Sequence:CCGGGCTACTAGAGACAGCTGTAAACTCGAGTTTACAGCTGTCTCTAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013715.1-1050s21c1
Sequence:CCGGGACTGATGTCTCAGGTTATTACTCGAGTAATAACCTGAGACATCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013715
VALIDATED
COPS5 MISSION shRNA Lentiviral Transduction Particles
COP9 signalosome subunit 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013715.1-486s1c1
Sequence:CCGGGCCTTGAGAATGCAATCGGTTCTCGAGAACCGATTGCATTCTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013715.1-652s1c1
Sequence:CCGGCGCCTTTAGGACATATCCAAACTCGAGTTTGGATATGTCCTAAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013715.1-438s1c1
Sequence:CCGGCGTATGAGTATATGGCTGCATCTCGAGATGCAGCCATATACTCATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013715.1-574s1c1
Sequence:CCGGCCAGCAGTTTCAAGAACCATTCTCGAGAATGGTTCTTGAAACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013715.1-1007s1c1
Sequence:CCGGGCTACTAGAGACAGCTGTAAACTCGAGTTTACAGCTGTCTCTAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013715.1-574s21c1
Sequence:CCGGCCAGCAGTTTCAAGAACCATTCTCGAGAATGGTTCTTGAAACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013715.1-163s21c1
Sequence:CCGGAGCGCAGAGTATCGATGAAATCTCGAGATTTCATCGATACTCTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013715.1-438s21c1
Sequence:CCGGCGTATGAGTATATGGCTGCATCTCGAGATGCAGCCATATACTCATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013715.1-1007s21c1
Sequence:CCGGGCTACTAGAGACAGCTGTAAACTCGAGTTTACAGCTGTCTCTAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013715.1-1050s21c1
Sequence:CCGGGACTGATGTCTCAGGTTATTACTCGAGTAATAACCTGAGACATCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006837
VALIDATED
COPS5 MISSION shRNA Bacterial Glycerol Stock
COP9 signalosome subunit 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006837.2-1288s1c1
Sequence:CCGGGTCTCAGGTTATTAAGGATAACTCGAGTTATCCTTAATAACCTGAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006837.2-597s1c1
Sequence:CCGGCCATGATCATTATGGACAGTTCTCGAGAACTGTCCATAATGATCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006837.2-462s1c1
Sequence:CCGGCCTGGACTAAGGATCACCATTCTCGAGAATGGTGATCCTTAGTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006837.2-940s1c1
Sequence:CCGGCCAGACTATTCCACTTAATAACTCGAGTTATTAAGTGGAATAGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006837.2-883s1c1
Sequence:CCGGCGCCTTTAGGACATACCCAAACTCGAGTTTGGGTATGTCCTAAAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006837.2-468s21c1
Sequence:CCGGCTAAGGATCACCATTACTTTACTCGAGTAAAGTAATGGTGATCCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343837    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006837.2-1338s21c1
Sequence:CCGGCAGTCTCTGAGAAGTACTTTACTCGAGTAAAGTACTTCTCAGAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006837.2-938s21c1
Sequence:CCGGTACCAGACTATTCCACTTAATCTCGAGATTAAGTGGAATAGTCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006837.2-883s21c1
Sequence:CCGGCGCCTTTAGGACATACCCAAACTCGAGTTTGGGTATGTCCTAAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006837.2-1288s21c1
Sequence:CCGGGTCTCAGGTTATTAAGGATAACTCGAGTTATCCTTAATAACCTGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006837
VALIDATED
COPS5 MISSION shRNA shRNA Plasmid DNA
COP9 signalosome subunit 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006837.2-1288s1c1
Sequence:CCGGGTCTCAGGTTATTAAGGATAACTCGAGTTATCCTTAATAACCTGAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006837.2-597s1c1
Sequence:CCGGCCATGATCATTATGGACAGTTCTCGAGAACTGTCCATAATGATCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006837.2-462s1c1
Sequence:CCGGCCTGGACTAAGGATCACCATTCTCGAGAATGGTGATCCTTAGTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006837.2-940s1c1
Sequence:CCGGCCAGACTATTCCACTTAATAACTCGAGTTATTAAGTGGAATAGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006837.2-883s1c1
Sequence:CCGGCGCCTTTAGGACATACCCAAACTCGAGTTTGGGTATGTCCTAAAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006837.2-468s21c1
Sequence:CCGGCTAAGGATCACCATTACTTTACTCGAGTAAAGTAATGGTGATCCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343837    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006837.2-1338s21c1
Sequence:CCGGCAGTCTCTGAGAAGTACTTTACTCGAGTAAAGTACTTCTCAGAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006837.2-938s21c1
Sequence:CCGGTACCAGACTATTCCACTTAATCTCGAGATTAAGTGGAATAGTCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006837.2-883s21c1
Sequence:CCGGCGCCTTTAGGACATACCCAAACTCGAGTTTGGGTATGTCCTAAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006837.2-1288s21c1
Sequence:CCGGGTCTCAGGTTATTAAGGATAACTCGAGTTATCCTTAATAACCTGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006837
VALIDATED
COPS5 MISSION shRNA Lentiviral Transduction Particles
COP9 signalosome subunit 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006837.2-1288s1c1
Sequence:CCGGGTCTCAGGTTATTAAGGATAACTCGAGTTATCCTTAATAACCTGAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006837.2-597s1c1
Sequence:CCGGCCATGATCATTATGGACAGTTCTCGAGAACTGTCCATAATGATCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006837.2-462s1c1
Sequence:CCGGCCTGGACTAAGGATCACCATTCTCGAGAATGGTGATCCTTAGTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006837.2-940s1c1
Sequence:CCGGCCAGACTATTCCACTTAATAACTCGAGTTATTAAGTGGAATAGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006837.2-883s1c1
Sequence:CCGGCGCCTTTAGGACATACCCAAACTCGAGTTTGGGTATGTCCTAAAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006837.2-468s21c1
Sequence:CCGGCTAAGGATCACCATTACTTTACTCGAGTAAAGTAATGGTGATCCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343837    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006837.2-1338s21c1
Sequence:CCGGCAGTCTCTGAGAAGTACTTTACTCGAGTAAAGTACTTCTCAGAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006837.2-938s21c1
Sequence:CCGGTACCAGACTATTCCACTTAATCTCGAGATTAAGTGGAATAGTCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006837.2-883s21c1
Sequence:CCGGCGCCTTTAGGACATACCCAAACTCGAGTTTGGGTATGTCCTAAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006837.2-1288s21c1
Sequence:CCGGGTCTCAGGTTATTAAGGATAACTCGAGTTATCCTTAATAACCTGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks