EMAIL THIS PAGE TO A FRIEND

COPS6

COP9 signalosome subunit 6

64 Gene Product Result for
Synonyms: CSN6 MOV34-34KD
UniProtKB ID: Q7L5N1, A4D2A3, O15387
Gene ID:
Human(10980) Summary: The protein encoded by this gene is one of the eight subunits of COP9 signalosome, a highly conserved protein complex that functions as an important regulator in multiple signaling pathways. The structure and function of COP9 signalosome is similar to that of the 19S regulatory particle of 26S proteasome. COP9 signalosome has been shown to interact with SCF-type E3 ubiquitin ligases and act as a positive regulator of E3 ubiquitin ligases. This protein belongs to translation initiation factor 3 (eIF3) superfamily. It is involved in the regulation of cell cycle and likely to be a cellular cofactor for HIV-1 accessory gene product Vpr. [provided by RefSeq, Jul 2008]
Mouse(26893) COP9 (constitutive photomorphogenic) homolog, subunit 6 (Arabidopsis thaliana)
Rat(304343) COP9 signalosome subunit 6
Zebrafish(550465) COP9 constitutive photomorphogenic homolog subunit 6 (Arabidopsis)
domestic cat(101088133) COP9 constitutive photomorphogenic homolog subunit 6 (Arabidopsis)
cow(512756) COP9 constitutive photomorphogenic homolog subunit 6 (Arabidopsis)
dog(479738) COP9 constitutive photomorphogenic homolog subunit 6 (Arabidopsis)
domestic guinea pig(100719508) COP9 signalosome subunit 6
naked mole-rat(101724377) COP9 signalosome subunit 6
sheep(101108276) COP9 constitutive photomorphogenic homolog subunit 6 (Arabidopsis)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012002 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_012002 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_012002 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006833 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006833 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006833 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006833 Rosetta Predictions human pricing
NM_001107129 Rosetta Predictions rat pricing
NM_012002 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006833 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342398 predicted 505
2 SASI_Hs01_00117938 predicted 1160
3 SASI_Hs01_00117939 predicted 982
4 SASI_Hs02_00342399 predicted 380
5 SASI_Hs01_00117941 predicted 1079
6 SASI_Hs01_00117942 predicted 422
7 SASI_Hs01_00117943 predicted 730
8 SASI_Hs01_00117944 predicted 588
9 SASI_Hs01_00117945 predicted 348
10 SASI_Hs01_00117946 predicted 494
11 SASI_Hs01_00117940 predicted 926
12 SASI_Hs01_00117947 predicted 1146
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107129 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225786 predicted 697
2 SASI_Rn02_00225787 predicted 947
3 SASI_Rn02_00225788 predicted 865
4 SASI_Rn02_00225789 predicted 469
5 SASI_Rn02_00225790 predicted 579
6 SASI_Rn02_00225791 predicted 300
7 SASI_Rn02_00225792 predicted 527
8 SASI_Rn02_00225793 predicted 370
9 SASI_Rn02_00225794 predicted 516
10 SASI_Rn02_00225795 predicted 945
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012002 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107878 predicted 480
2 SASI_Mm01_00107879 predicted 440
3 SASI_Mm01_00107880 predicted 613
4 SASI_Mm01_00107881 predicted 651
5 SASI_Mm01_00107882 predicted 819
6 SASI_Mm01_00107883 predicted 475
7 SASI_Mm01_00107884 predicted 354
8 SASI_Mm01_00107885 predicted 639
9 SASI_Mm01_00107886 predicted 279
10 SASI_Mm01_00107887 predicted 391
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012002
VALIDATED
COPS6 MISSION shRNA Bacterial Glycerol Stock
COP9 signalosome subunit 6
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000326726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012002.3-236s21c1
Sequence:CCGGGCGAAATATCGAAGTGATGAACTCGAGTTCATCACTTCGATATTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012002.3-468s21c1
Sequence:CCGGCCTATGACCAAGCACACAGATCTCGAGATCTGTGTGCTTGGTCATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012002.3-896s21c1
Sequence:CCGGGTGCAACACAATGAACCAGTTCTCGAGAACTGGTTCATTGTGTTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012002.3-819s21c1
Sequence:CCGGGACAAGTTCAAGACAGACTTTCTCGAGAAAGTCTGTCTTGAACTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012002.3-100s21c1
Sequence:CCGGCCGGAGTGACTGGGAGTGTTTCTCGAGAAACACTCCCAGTCACTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012002.1-240s1c1
Sequence:CCGGGCGAAATATCGAAGTGATGAACTCGAGTTCATCACTTCGATATTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012002.1-104s1c1
Sequence:CCGGCCGGAGTGACTGGGAGTGTTTCTCGAGAAACACTCCCAGTCACTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012002.1-823s1c1
Sequence:CCGGGACAAGTTCAAGACAGACTTTCTCGAGAAAGTCTGTCTTGAACTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012002.1-900s1c1
Sequence:CCGGGTGCAACACAATGAACCAGTTCTCGAGAACTGGTTCATTGTGTTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012002.1-472s1c1
Sequence:CCGGCCTATGACCAAGCACACAGATCTCGAGATCTGTGTGCTTGGTCATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012002
VALIDATED
COPS6 MISSION shRNA shRNA Plasmid DNA
COP9 signalosome subunit 6
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000326726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012002.3-236s21c1
Sequence:CCGGGCGAAATATCGAAGTGATGAACTCGAGTTCATCACTTCGATATTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012002.3-468s21c1
Sequence:CCGGCCTATGACCAAGCACACAGATCTCGAGATCTGTGTGCTTGGTCATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012002.3-896s21c1
Sequence:CCGGGTGCAACACAATGAACCAGTTCTCGAGAACTGGTTCATTGTGTTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012002.3-819s21c1
Sequence:CCGGGACAAGTTCAAGACAGACTTTCTCGAGAAAGTCTGTCTTGAACTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012002.3-100s21c1
Sequence:CCGGCCGGAGTGACTGGGAGTGTTTCTCGAGAAACACTCCCAGTCACTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012002.1-240s1c1
Sequence:CCGGGCGAAATATCGAAGTGATGAACTCGAGTTCATCACTTCGATATTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012002.1-104s1c1
Sequence:CCGGCCGGAGTGACTGGGAGTGTTTCTCGAGAAACACTCCCAGTCACTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012002.1-823s1c1
Sequence:CCGGGACAAGTTCAAGACAGACTTTCTCGAGAAAGTCTGTCTTGAACTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012002.1-900s1c1
Sequence:CCGGGTGCAACACAATGAACCAGTTCTCGAGAACTGGTTCATTGTGTTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012002.1-472s1c1
Sequence:CCGGCCTATGACCAAGCACACAGATCTCGAGATCTGTGTGCTTGGTCATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012002
VALIDATED
COPS6 MISSION shRNA Lentiviral Transduction Particles
COP9 signalosome subunit 6
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000326726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012002.3-236s21c1
Sequence:CCGGGCGAAATATCGAAGTGATGAACTCGAGTTCATCACTTCGATATTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012002.3-468s21c1
Sequence:CCGGCCTATGACCAAGCACACAGATCTCGAGATCTGTGTGCTTGGTCATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012002.3-896s21c1
Sequence:CCGGGTGCAACACAATGAACCAGTTCTCGAGAACTGGTTCATTGTGTTGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012002.3-819s21c1
Sequence:CCGGGACAAGTTCAAGACAGACTTTCTCGAGAAAGTCTGTCTTGAACTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012002.3-100s21c1
Sequence:CCGGCCGGAGTGACTGGGAGTGTTTCTCGAGAAACACTCCCAGTCACTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012002.1-240s1c1
Sequence:CCGGGCGAAATATCGAAGTGATGAACTCGAGTTCATCACTTCGATATTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012002.1-104s1c1
Sequence:CCGGCCGGAGTGACTGGGAGTGTTTCTCGAGAAACACTCCCAGTCACTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012002.1-823s1c1
Sequence:CCGGGACAAGTTCAAGACAGACTTTCTCGAGAAAGTCTGTCTTGAACTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012002.1-900s1c1
Sequence:CCGGGTGCAACACAATGAACCAGTTCTCGAGAACTGGTTCATTGTGTTGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012002.1-472s1c1
Sequence:CCGGCCTATGACCAAGCACACAGATCTCGAGATCTGTGTGCTTGGTCATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006833
VALIDATED
COPS6 MISSION shRNA Bacterial Glycerol Stock
COP9 signalosome subunit 6
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006833.4-265s21c1
Sequence:CCGGCCGAAATATCGAGGTGATGAACTCGAGTTCATCACCTCGATATTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006833.4-165s21c1
Sequence:CCGGCCCTTGTCATTCTCAACATCTCTCGAGAGATGTTGAGAATGACAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006833.4-310s21c1
Sequence:CCGGCGTGGAAGAGAAGATTATCATCTCGAGATGATAATCTTCTCTTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006833.4-941s21c1
Sequence:CCGGCAGTTTGTGAACAAGTTCAATCTCGAGATTGAACTTGTTCACAAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006833.4-1084s21c1
Sequence:CCGGCTTGAGAGAAACCGCTGTCATCTCGAGATGACAGCGGTTTCTCTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072558    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006833.4-1084s1c1
Sequence:CCGGCTTGAGAGAAACCGCTGTCATCTCGAGATGACAGCGGTTTCTCTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_006833.4-265s1c1
Sequence:CCGGCCGAAATATCGAGGTGATGAACTCGAGTTCATCACCTCGATATTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006833.4-941s1c1
Sequence:CCGGCAGTTTGTGAACAAGTTCAATCTCGAGATTGAACTTGTTCACAAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006833.4-310s1c1
Sequence:CCGGCGTGGAAGAGAAGATTATCATCTCGAGATGATAATCTTCTCTTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006833.4-165s1c1
Sequence:CCGGCCCTTGTCATTCTCAACATCTCTCGAGAGATGTTGAGAATGACAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006833
VALIDATED
COPS6 MISSION shRNA shRNA Plasmid DNA
COP9 signalosome subunit 6
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006833.4-265s21c1
Sequence:CCGGCCGAAATATCGAGGTGATGAACTCGAGTTCATCACCTCGATATTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006833.4-165s21c1
Sequence:CCGGCCCTTGTCATTCTCAACATCTCTCGAGAGATGTTGAGAATGACAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006833.4-310s21c1
Sequence:CCGGCGTGGAAGAGAAGATTATCATCTCGAGATGATAATCTTCTCTTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006833.4-941s21c1
Sequence:CCGGCAGTTTGTGAACAAGTTCAATCTCGAGATTGAACTTGTTCACAAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006833.4-1084s21c1
Sequence:CCGGCTTGAGAGAAACCGCTGTCATCTCGAGATGACAGCGGTTTCTCTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072558    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006833.4-1084s1c1
Sequence:CCGGCTTGAGAGAAACCGCTGTCATCTCGAGATGACAGCGGTTTCTCTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_006833.4-265s1c1
Sequence:CCGGCCGAAATATCGAGGTGATGAACTCGAGTTCATCACCTCGATATTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006833.4-941s1c1
Sequence:CCGGCAGTTTGTGAACAAGTTCAATCTCGAGATTGAACTTGTTCACAAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006833.4-310s1c1
Sequence:CCGGCGTGGAAGAGAAGATTATCATCTCGAGATGATAATCTTCTCTTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006833.4-165s1c1
Sequence:CCGGCCCTTGTCATTCTCAACATCTCTCGAGAGATGTTGAGAATGACAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006833
VALIDATED
COPS6 MISSION shRNA Lentiviral Transduction Particles
COP9 signalosome subunit 6
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006833.4-265s21c1
Sequence:CCGGCCGAAATATCGAGGTGATGAACTCGAGTTCATCACCTCGATATTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006833.4-165s21c1
Sequence:CCGGCCCTTGTCATTCTCAACATCTCTCGAGAGATGTTGAGAATGACAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006833.4-310s21c1
Sequence:CCGGCGTGGAAGAGAAGATTATCATCTCGAGATGATAATCTTCTCTTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006833.4-941s21c1
Sequence:CCGGCAGTTTGTGAACAAGTTCAATCTCGAGATTGAACTTGTTCACAAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006833.4-1084s21c1
Sequence:CCGGCTTGAGAGAAACCGCTGTCATCTCGAGATGACAGCGGTTTCTCTCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072558    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006833.4-1084s1c1
Sequence:CCGGCTTGAGAGAAACCGCTGTCATCTCGAGATGACAGCGGTTTCTCTCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_006833.4-265s1c1
Sequence:CCGGCCGAAATATCGAGGTGATGAACTCGAGTTCATCACCTCGATATTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006833.4-941s1c1
Sequence:CCGGCAGTTTGTGAACAAGTTCAATCTCGAGATTGAACTTGTTCACAAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006833.4-310s1c1
Sequence:CCGGCGTGGAAGAGAAGATTATCATCTCGAGATGATAATCTTCTCTTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006833.4-165s1c1
Sequence:CCGGCCCTTGTCATTCTCAACATCTCTCGAGAGATGTTGAGAATGACAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)