EMAIL THIS PAGE TO A FRIEND

COPS7A

COP9 signalosome subunit 7A

109 Gene Product Result for
Synonyms: CSN7A
UniProtKB ID: Q9UBW8, A8K9A6, Q9NVX3, Q9UJW4
Gene ID:
Mouse(26894) COP9 (constitutive photomorphogenic) homolog, subunit 7a (Arabidopsis thaliana)
Rat(312710) COP9 signalosome subunit 7A
sheep(101111008) COP9 constitutive photomorphogenic homolog subunit 7A (Arabidopsis)
naked mole-rat(101714628) COP9 signalosome subunit 7A
domestic guinea pig(100726443) COP9 signalosome subunit 7A
Zebrafish(336736) COP9 constitutive photomorphogenic homolog subunit 7A
cow(505079) COP9 constitutive photomorphogenic homolog subunit 7A (Arabidopsis)
chicken(418283) COP9 constitutive photomorphogenic homolog subunit 7A (Arabidopsis)
dog(486722) COP9 constitutive photomorphogenic homolog subunit 7A (Arabidopsis)
domestic cat(101083858) COP9 constitutive photomorphogenic homolog subunit 7A (Arabidopsis)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA026915 Anti-COPS7A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2105125 Anti-COPS7A antibody produced in rabbit affinity isolated antibody guinea pig, mouse, rabbit, human, rat, horse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012003 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_012003 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_012003 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016319 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016319 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016319 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016319 Rosetta Predictions human pricing
NM_001047098 Rosetta Predictions rat pricing
NM_012003 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016319 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246901 predicted 943
2 SASI_Hs01_00246902 predicted 1057
3 SASI_Hs01_00246903 predicted 1245
4 SASI_Hs02_00349255 predicted 401
5 SASI_Hs01_00246904 predicted 380
6 SASI_Hs01_00246906 predicted 354
7 SASI_Hs01_00246907 predicted 348
8 SASI_Hs01_00246908 predicted 449
9 SASI_Hs01_00246909 predicted 1211
10 SASI_Hs01_00246910 predicted 473
11 SASI_Hs01_00246905 predicted 479
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047098 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205914 predicted 712
2 SASI_Rn02_00205915 predicted 278
3 SASI_Rn02_00205916 predicted 316
4 SASI_Rn02_00205917 predicted 281
5 SASI_Rn02_00205918 predicted 399
6 SASI_Rn02_00205919 predicted 210
7 SASI_Rn02_00205920 predicted 422
8 SASI_Rn02_00205921 predicted 414
9 SASI_Rn02_00205922 predicted 316
10 SASI_Rn02_00205923 predicted 259
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012003 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046627 predicted 360
2 SASI_Mm01_00046628 predicted 371
3 SASI_Mm01_00046629 predicted 435
4 SASI_Mm01_00046630 predicted 597
5 SASI_Mm01_00046631 predicted 462
6 SASI_Mm01_00046633 predicted 291
7 SASI_Mm01_00046634 predicted 1168
8 SASI_Mm01_00046635 predicted 330
9 SASI_Mm01_00046636 predicted 283
10 SASI_Mm02_00321942 predicted 361
11 SASI_Mm01_00046632 predicted 446
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012003
VALIDATED
COPS7A MISSION shRNA Bacterial Glycerol Stock
COP9 signalosome subunit 7A
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120882    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012003.1-1158s1c1
Sequence:CCGGGCAGGTCATGTTCTGTTGGTACTCGAGTACCAACAGAACATGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012003.1-476s1c1
Sequence:CCGGCAAAGTCAAGTGTATCCCATACTCGAGTATGGGATACACTTGACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012003.1-475s1c1
Sequence:CCGGCCAAAGTCAAGTGTATCCCATCTCGAGATGGGATACACTTGACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012003.1-432s1c1
Sequence:CCGGCAGAAGAATAAGCTTCGACATCTCGAGATGTCGAAGCTTATTCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012003.2-289s21c1
Sequence:CCGGGAACTGCTGGATATGCCTAATCTCGAGATTAGGCATATCCAGCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012003.1-605s21c1
Sequence:CCGGTCAGCGGCTAGAGGTTGATTACTCGAGTAATCAACCTCTAGCCGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340166    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012003.1-1158s21c1
Sequence:CCGGGCAGGTCATGTTCTGTTGGTACTCGAGTACCAACAGAACATGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012003.1-475s21c1
Sequence:CCGGCCAAAGTCAAGTGTATCCCATCTCGAGATGGGATACACTTGACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012003.2-374s21c1
Sequence:CCGGGGACCTATGCGGACTACTTAGCTCGAGCTAAGTAGTCCGCATAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012003
VALIDATED
COPS7A MISSION shRNA shRNA Plasmid DNA
COP9 signalosome subunit 7A
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120882    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012003.1-1158s1c1
Sequence:CCGGGCAGGTCATGTTCTGTTGGTACTCGAGTACCAACAGAACATGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012003.1-476s1c1
Sequence:CCGGCAAAGTCAAGTGTATCCCATACTCGAGTATGGGATACACTTGACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012003.1-475s1c1
Sequence:CCGGCCAAAGTCAAGTGTATCCCATCTCGAGATGGGATACACTTGACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012003.1-432s1c1
Sequence:CCGGCAGAAGAATAAGCTTCGACATCTCGAGATGTCGAAGCTTATTCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012003.2-289s21c1
Sequence:CCGGGAACTGCTGGATATGCCTAATCTCGAGATTAGGCATATCCAGCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012003.1-605s21c1
Sequence:CCGGTCAGCGGCTAGAGGTTGATTACTCGAGTAATCAACCTCTAGCCGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340166    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012003.1-1158s21c1
Sequence:CCGGGCAGGTCATGTTCTGTTGGTACTCGAGTACCAACAGAACATGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012003.1-475s21c1
Sequence:CCGGCCAAAGTCAAGTGTATCCCATCTCGAGATGGGATACACTTGACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012003.2-374s21c1
Sequence:CCGGGGACCTATGCGGACTACTTAGCTCGAGCTAAGTAGTCCGCATAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012003
VALIDATED
COPS7A MISSION shRNA Lentiviral Transduction Particles
COP9 signalosome subunit 7A
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120882    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012003.1-1158s1c1
Sequence:CCGGGCAGGTCATGTTCTGTTGGTACTCGAGTACCAACAGAACATGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012003.1-476s1c1
Sequence:CCGGCAAAGTCAAGTGTATCCCATACTCGAGTATGGGATACACTTGACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012003.1-475s1c1
Sequence:CCGGCCAAAGTCAAGTGTATCCCATCTCGAGATGGGATACACTTGACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012003.1-432s1c1
Sequence:CCGGCAGAAGAATAAGCTTCGACATCTCGAGATGTCGAAGCTTATTCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012003.2-289s21c1
Sequence:CCGGGAACTGCTGGATATGCCTAATCTCGAGATTAGGCATATCCAGCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012003.1-605s21c1
Sequence:CCGGTCAGCGGCTAGAGGTTGATTACTCGAGTAATCAACCTCTAGCCGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340166    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012003.1-1158s21c1
Sequence:CCGGGCAGGTCATGTTCTGTTGGTACTCGAGTACCAACAGAACATGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012003.1-475s21c1
Sequence:CCGGCCAAAGTCAAGTGTATCCCATCTCGAGATGGGATACACTTGACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012003.2-374s21c1
Sequence:CCGGGGACCTATGCGGACTACTTAGCTCGAGCTAAGTAGTCCGCATAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016319
VALIDATED
COPS7A MISSION shRNA Bacterial Glycerol Stock
COP9 signalosome subunit 7A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_016319.1-945s1c1
Sequence:CCGGCAAGATTTGGTCCAAGTCGAACTCGAGTTCGACTTGGACCAAATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_016319.1-770s1c1
Sequence:CCGGAGAGTGAGGTTGCCAACCTTACTCGAGTAAGGTTGGCAACCTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_016319.1-760s1c1
Sequence:CCGGCAGCAGATTGAGAGTGAGGTTCTCGAGAACCTCACTCTCAATCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_016319.1-386s1c1
Sequence:CCGGCCCGGAATCTTCCTCCACTAACTCGAGTTAGTGGAGGAAGATTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117802    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016319.1-1248s1c1
Sequence:CCGGCCCTGTTCATTACATGTCATTCTCGAGAATGACATGTAATGAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333463    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016319.2-1289s21c1
Sequence:CCGGCCCTGTTCATTACATGTCATTCTCGAGAATGACATGTAATGAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016319.2-811s21c1
Sequence:CCGGAGAGTGAGGTTGCCAACCTTACTCGAGTAAGGTTGGCAACCTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016319.2-801s21c1
Sequence:CCGGCAGCAGATTGAGAGTGAGGTTCTCGAGAACCTCACTCTCAATCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016319.2-427s21c1
Sequence:CCGGCCCGGAATCTTCCTCCACTAACTCGAGTTAGTGGAGGAAGATTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016319
VALIDATED
COPS7A MISSION shRNA shRNA Plasmid DNA
COP9 signalosome subunit 7A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_016319.1-945s1c1
Sequence:CCGGCAAGATTTGGTCCAAGTCGAACTCGAGTTCGACTTGGACCAAATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_016319.1-770s1c1
Sequence:CCGGAGAGTGAGGTTGCCAACCTTACTCGAGTAAGGTTGGCAACCTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_016319.1-760s1c1
Sequence:CCGGCAGCAGATTGAGAGTGAGGTTCTCGAGAACCTCACTCTCAATCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_016319.1-386s1c1
Sequence:CCGGCCCGGAATCTTCCTCCACTAACTCGAGTTAGTGGAGGAAGATTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117802    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016319.1-1248s1c1
Sequence:CCGGCCCTGTTCATTACATGTCATTCTCGAGAATGACATGTAATGAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333463    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016319.2-1289s21c1
Sequence:CCGGCCCTGTTCATTACATGTCATTCTCGAGAATGACATGTAATGAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016319.2-811s21c1
Sequence:CCGGAGAGTGAGGTTGCCAACCTTACTCGAGTAAGGTTGGCAACCTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016319.2-801s21c1
Sequence:CCGGCAGCAGATTGAGAGTGAGGTTCTCGAGAACCTCACTCTCAATCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016319.2-427s21c1
Sequence:CCGGCCCGGAATCTTCCTCCACTAACTCGAGTTAGTGGAGGAAGATTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016319
VALIDATED
COPS7A MISSION shRNA Lentiviral Transduction Particles
COP9 signalosome subunit 7A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_016319.1-945s1c1
Sequence:CCGGCAAGATTTGGTCCAAGTCGAACTCGAGTTCGACTTGGACCAAATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_016319.1-770s1c1
Sequence:CCGGAGAGTGAGGTTGCCAACCTTACTCGAGTAAGGTTGGCAACCTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_016319.1-760s1c1
Sequence:CCGGCAGCAGATTGAGAGTGAGGTTCTCGAGAACCTCACTCTCAATCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_016319.1-386s1c1
Sequence:CCGGCCCGGAATCTTCCTCCACTAACTCGAGTTAGTGGAGGAAGATTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117802    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016319.1-1248s1c1
Sequence:CCGGCCCTGTTCATTACATGTCATTCTCGAGAATGACATGTAATGAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333463    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016319.2-1289s21c1
Sequence:CCGGCCCTGTTCATTACATGTCATTCTCGAGAATGACATGTAATGAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016319.2-811s21c1
Sequence:CCGGAGAGTGAGGTTGCCAACCTTACTCGAGTAAGGTTGGCAACCTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016319.2-801s21c1
Sequence:CCGGCAGCAGATTGAGAGTGAGGTTCTCGAGAACCTCACTCTCAATCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016319.2-427s21c1
Sequence:CCGGCCCGGAATCTTCCTCCACTAACTCGAGTTAGTGGAGGAAGATTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks