EMAIL THIS PAGE TO A FRIEND

COPS7B

COP9 signalosome subunit 7B

210 Gene Product Result for
Synonyms: CSN7B
UniProtKB ID: Q9H9Q2, Q53S22, Q5BJG3, Q9H7V6
Gene ID:
Mouse(26895) COP9 (constitutive photomorphogenic) homolog, subunit 7b (Arabidopsis thaliana)
Rat(363273) COP9 signalosome subunit 7B
chicken(424933) COP9 constitutive photomorphogenic homolog subunit 7B (Arabidopsis)
domestic cat(101097011) COP9 constitutive photomorphogenic homolog subunit 7B (Arabidopsis)
cow(617995) COP9 constitutive photomorphogenic homolog subunit 7B (Arabidopsis)
dog(610156) COP9 constitutive photomorphogenic homolog subunit 7B (Arabidopsis)
domestic guinea pig(100725494) COP9 signalosome subunit 7B
naked mole-rat(101703128) COP9 signalosome subunit 7B
sheep(100302337) COP9 constitutive photomorphogenic homolog subunit 7B (Arabidopsis)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172974 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172974 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172974 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022730 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022730 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022730 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU026181 MISSION® esiRNA esiRNA human COPS7B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022730 Rosetta Predictions human pricing
NM_001108807 Rosetta Predictions rat pricing
NM_172974 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022730 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200717 predicted 199
2 SASI_Hs01_00200718 predicted 586
3 SASI_Hs01_00200719 predicted 470
4 SASI_Hs01_00200720 predicted 328
5 SASI_Hs02_00355953 predicted 465
6 SASI_Hs01_00200722 predicted 318
7 SASI_Hs01_00200723 predicted 306
8 SASI_Hs02_00355954 predicted 580
9 SASI_Hs01_00200724 predicted 643
10 SASI_Hs01_00200725 predicted 490
11 SASI_Hs01_00200721 predicted 274
12 SASI_Hs01_00200726 predicted 680
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108807 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242265 predicted 881
2 SASI_Rn02_00242266 predicted 759
3 SASI_Rn02_00242267 predicted 615
4 SASI_Rn02_00242268 predicted 941
5 SASI_Rn02_00242269 predicted 900
6 SASI_Rn02_00242270 predicted 571
7 SASI_Rn02_00242271 predicted 413
8 SASI_Rn02_00242272 predicted 757
9 SASI_Rn02_00242273 predicted 1138
10 SASI_Rn02_00242274 predicted 575
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172974 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345022 predicted 636
2 SASI_Mm01_00051094 predicted 322
3 SASI_Mm01_00051095 predicted 517
4 SASI_Mm02_00345023 predicted 317
5 SASI_Mm01_00051096 predicted 373
6 SASI_Mm01_00051098 predicted 896
7 SASI_Mm01_00051099 predicted 573
8 SASI_Mm02_00345024 predicted 697
9 SASI_Mm01_00051101 predicted 1013
10 SASI_Mm01_00051102 predicted 329
11 SASI_Mm01_00051093 predicted 636
12 SASI_Mm01_00051097 predicted 568
13 SASI_Mm01_00051100 predicted 552
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172974
VALIDATED
COPS7B MISSION shRNA Bacterial Glycerol Stock
COP9 signalosome subunit 7B
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172974.2-181s21c1
Sequence:CCGGACCTCTTGGAGCAGTTCATTTCTCGAGAAATGAACTGCTCCAAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172974.2-377s21c1
Sequence:CCGGCCCGGATTACATAGCCAACAACTCGAGTTGTTGGCTATGTAATCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336385    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172974.2-1274s21c1
Sequence:CCGGCCTAAGCTGGAGGCAGTTTACCTCGAGGTAAACTGCCTCCAGCTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172974.2-637s21c1
Sequence:CCGGTCCGGAAGAAAGATATCAATACTCGAGTATTGATATCTTTCTTCCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172974.2-324s21c1
Sequence:CCGGGGAGCTAATGCTGCGTATTTGCTCGAGCAAATACGCAGCATTAGCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172974.2-528s21c1
Sequence:CCGGAGGGAACTAGAAGACCTTATCCTCGAGGATAAGGTCTTCTAGTTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120897    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172974.1-1150s1c1
Sequence:CCGGGCTCAATGGATGCCATCGTAACTCGAGTTACGATGGCATCCATTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172974.1-785s1c1
Sequence:CCGGCGAGGTTAGCAACATTAAGAACTCGAGTTCTTAATGTTGCTAACCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172974.1-364s1c1
Sequence:CCGGCCTATGGTACATACCCGGATTCTCGAGAATCCGGGTATGTACCATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172974.1-377s1c1
Sequence:CCGGCCCGGATTACATAGCCAACAACTCGAGTTGTTGGCTATGTAATCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172974
VALIDATED
COPS7B MISSION shRNA shRNA Plasmid DNA
COP9 signalosome subunit 7B
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172974.2-181s21c1
Sequence:CCGGACCTCTTGGAGCAGTTCATTTCTCGAGAAATGAACTGCTCCAAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172974.2-377s21c1
Sequence:CCGGCCCGGATTACATAGCCAACAACTCGAGTTGTTGGCTATGTAATCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336385    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172974.2-1274s21c1
Sequence:CCGGCCTAAGCTGGAGGCAGTTTACCTCGAGGTAAACTGCCTCCAGCTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172974.2-637s21c1
Sequence:CCGGTCCGGAAGAAAGATATCAATACTCGAGTATTGATATCTTTCTTCCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172974.2-324s21c1
Sequence:CCGGGGAGCTAATGCTGCGTATTTGCTCGAGCAAATACGCAGCATTAGCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172974.2-528s21c1
Sequence:CCGGAGGGAACTAGAAGACCTTATCCTCGAGGATAAGGTCTTCTAGTTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120897    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172974.1-1150s1c1
Sequence:CCGGGCTCAATGGATGCCATCGTAACTCGAGTTACGATGGCATCCATTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172974.1-785s1c1
Sequence:CCGGCGAGGTTAGCAACATTAAGAACTCGAGTTCTTAATGTTGCTAACCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172974.1-364s1c1
Sequence:CCGGCCTATGGTACATACCCGGATTCTCGAGAATCCGGGTATGTACCATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172974.1-377s1c1
Sequence:CCGGCCCGGATTACATAGCCAACAACTCGAGTTGTTGGCTATGTAATCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172974
VALIDATED
COPS7B MISSION shRNA Lentiviral Transduction Particles
COP9 signalosome subunit 7B
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172974.2-181s21c1
Sequence:CCGGACCTCTTGGAGCAGTTCATTTCTCGAGAAATGAACTGCTCCAAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172974.2-377s21c1
Sequence:CCGGCCCGGATTACATAGCCAACAACTCGAGTTGTTGGCTATGTAATCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336385    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172974.2-1274s21c1
Sequence:CCGGCCTAAGCTGGAGGCAGTTTACCTCGAGGTAAACTGCCTCCAGCTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172974.2-637s21c1
Sequence:CCGGTCCGGAAGAAAGATATCAATACTCGAGTATTGATATCTTTCTTCCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172974.2-324s21c1
Sequence:CCGGGGAGCTAATGCTGCGTATTTGCTCGAGCAAATACGCAGCATTAGCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172974.2-528s21c1
Sequence:CCGGAGGGAACTAGAAGACCTTATCCTCGAGGATAAGGTCTTCTAGTTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120897    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172974.1-1150s1c1
Sequence:CCGGGCTCAATGGATGCCATCGTAACTCGAGTTACGATGGCATCCATTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172974.1-785s1c1
Sequence:CCGGCGAGGTTAGCAACATTAAGAACTCGAGTTCTTAATGTTGCTAACCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172974.1-364s1c1
Sequence:CCGGCCTATGGTACATACCCGGATTCTCGAGAATCCGGGTATGTACCATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172974.1-377s1c1
Sequence:CCGGCCCGGATTACATAGCCAACAACTCGAGTTGTTGGCTATGTAATCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022730
COPS7B MISSION shRNA Bacterial Glycerol Stock
COP9 signalosome subunit 7B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022730.1-328s1c1
Sequence:CCGGCCCAGATTACATAGCCAACAACTCGAGTTGTTGGCTATGTAATCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022730.1-493s1c1
Sequence:CCGGCCTTATCATTGAGGCTGTCTACTCGAGTAGACAGCCTCAATGATAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022730.1-188s1c1
Sequence:CCGGGCTCTCATAAGCCAGGTCTTACTCGAGTAAGACCTGGCTTATGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022730.1-316s1c1
Sequence:CCGGCTATGGGACATACCCAGATTACTCGAGTAATCTGGGTATGTCCCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118152    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022730.1-1029s1c1
Sequence:CCGGCCTGTTGGTACTGTTCCAGAACTCGAGTTCTGGAACAGTACCAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022730
COPS7B MISSION shRNA shRNA Plasmid DNA
COP9 signalosome subunit 7B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022730.1-328s1c1
Sequence:CCGGCCCAGATTACATAGCCAACAACTCGAGTTGTTGGCTATGTAATCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022730.1-493s1c1
Sequence:CCGGCCTTATCATTGAGGCTGTCTACTCGAGTAGACAGCCTCAATGATAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022730.1-188s1c1
Sequence:CCGGGCTCTCATAAGCCAGGTCTTACTCGAGTAAGACCTGGCTTATGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022730.1-316s1c1
Sequence:CCGGCTATGGGACATACCCAGATTACTCGAGTAATCTGGGTATGTCCCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118152    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022730.1-1029s1c1
Sequence:CCGGCCTGTTGGTACTGTTCCAGAACTCGAGTTCTGGAACAGTACCAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022730
COPS7B MISSION shRNA Lentiviral Transduction Particles
COP9 signalosome subunit 7B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022730.1-328s1c1
Sequence:CCGGCCCAGATTACATAGCCAACAACTCGAGTTGTTGGCTATGTAATCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022730.1-493s1c1
Sequence:CCGGCCTTATCATTGAGGCTGTCTACTCGAGTAGACAGCCTCAATGATAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022730.1-188s1c1
Sequence:CCGGGCTCTCATAAGCCAGGTCTTACTCGAGTAAGACCTGGCTTATGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022730.1-316s1c1
Sequence:CCGGCTATGGGACATACCCAGATTACTCGAGTAATCTGGGTATGTCCCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118152    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022730.1-1029s1c1
Sequence:CCGGCCTGTTGGTACTGTTCCAGAACTCGAGTTCTGGAACAGTACCAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)