EMAIL THIS PAGE TO A FRIEND

COPS8

COP9 signalosome subunit 8

129 Gene Product Result for
Synonyms: COP9 CSN8 SGN8
UniProtKB ID: Q99627, A8K1H6, Q53QS9
Gene ID:
Human(10920) Summary: The protein encoded by this gene is one of the eight subunits of COP9 signalosome, a highly conserved protein complex that functions as an important regulator in multiple signaling pathways. The structure and function of COP9 signalosome is similar to that of the 19S regulatory particle of 26S proteasome. COP9 signalosome has been shown to interact with SCF-type E3 ubiquitin ligases and act as a positive regulator of E3 ubiquitin ligases. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
Mouse(108679) COP9 (constitutive photomorphogenic) homolog, subunit 8 (Arabidopsis thaliana)
Rat(363283) COP9 signalosome subunit 8
sheep(101102596) COP9 constitutive photomorphogenic homolog subunit 8 (Arabidopsis)
naked mole-rat(101716724) COP9 signalosome subunit 8
domestic guinea pig(100729283) COP9 signalosome subunit 8
Zebrafish(393198) COP9 constitutive photomorphogenic homolog subunit 8 (Arabidopsis)
cow(540493) COP9 constitutive photomorphogenic homolog subunit 8 (Arabidopsis)
domestic cat(101081071) COP9 constitutive photomorphogenic homolog subunit 8 (Arabidopsis)
dog(477417) COP9 constitutive photomorphogenic homolog subunit 8 (Arabidopsis)
chicken(424020) COP9 constitutive photomorphogenic homolog subunit 8 (Arabidopsis)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006710 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006710 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006710 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133805 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133805 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133805 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006710 Rosetta Predictions human pricing
NM_198189 Rosetta Predictions human pricing
NM_001013227 Rosetta Predictions rat pricing
NM_133805 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006710 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190497 predicted 830
2 SASI_Hs01_00190498 predicted 1288
3 SASI_Hs01_00190499 predicted 1230
4 SASI_Hs01_00190500 predicted 982
5 SASI_Hs01_00190501 predicted 1116
6 SASI_Hs01_00190502 predicted 897
7 SASI_Hs01_00190503 predicted 1381
8 SASI_Hs01_00190504 predicted 1185
9 SASI_Hs02_00342135 predicted 1206
10 SASI_Hs01_00190505 predicted 881
11 SASI_Hs01_00190506 predicted 1449
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198189 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128748 predicted 893
2 SASI_Hs01_00128749 predicted 1352
3 SASI_Hs01_00128750 predicted 1286
4 SASI_Hs01_00128751 predicted 1052
5 SASI_Hs01_00128752 predicted 1184
6 SASI_Hs01_00128753 predicted 956
7 SASI_Hs01_00128754 predicted 1452
8 SASI_Hs01_00128755 predicted 1251
9 SASI_Hs02_00371731 predicted 1271
10 SASI_Hs01_00128756 predicted 942
11 SASI_Hs01_00128757 predicted 1524
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013227 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085687 predicted 239
2 SASI_Rn01_00085688 predicted 475
3 SASI_Rn01_00085689 predicted 1178
4 SASI_Rn01_00085690 predicted 583
5 SASI_Rn01_00085691 predicted 797
6 SASI_Rn01_00085692 predicted 646
7 SASI_Rn01_00085693 predicted 226
8 SASI_Rn01_00085694 predicted 361
9 SASI_Rn01_00085695 predicted 562
10 SASI_Rn02_00201039 predicted 773
11 SASI_Rn01_00085696 predicted 367
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133805 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188638 predicted 874
2 SASI_Mm01_00188639 predicted 304
3 SASI_Mm01_00188640 predicted 970
4 SASI_Mm01_00188641 predicted 555
5 SASI_Mm01_00188642 predicted 375
6 SASI_Mm01_00188643 predicted 294
7 SASI_Mm01_00188644 predicted 433
8 SASI_Mm01_00188645 predicted 269
9 SASI_Mm01_00188646 predicted 719
10 SASI_Mm01_00188647 predicted 844
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006710
VALIDATED
COPS8 MISSION shRNA Bacterial Glycerol Stock
COP9 signalosome subunit 8
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006710.4-659s1c1
Sequence:CCGGGCTCCATAATGACATGAATAACTCGAGTTATTCATGTCATTATGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007619    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006710.4-1644s1c1
Sequence:CCGGCCACTAATGTAAGATACAGAACTCGAGTTCTGTATCTTACATTAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006710.4-1037s1c1
Sequence:CCGGCCTGGATGTTTCCTTTAACAACTCGAGTTGTTAAAGGAAACATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006710.4-831s1c1
Sequence:CCGGCAGCCAATTATGGAAGCACTTCTCGAGAAGTGCTTCCATAATTGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006710.4-954s1c1
Sequence:CCGGGCTGTGAAAGGCATATTAGAACTCGAGTTCTAATATGCCTTTCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006710.4-954s21c1
Sequence:CCGGGCTGTGAAAGGCATATTAGAACTCGAGTTCTAATATGCCTTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315149    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006710.4-1644s21c1
Sequence:CCGGCCACTAATGTAAGATACAGAACTCGAGTTCTGTATCTTACATTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006710.4-1113s21c1
Sequence:CCGGTTAGCCAGACTGACGGATTATCTCGAGATAATCCGTCAGTCTGGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006710.4-1037s21c1
Sequence:CCGGCCTGGATGTTTCCTTTAACAACTCGAGTTGTTAAAGGAAACATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006710.4-775s21c1
Sequence:CCGGGAGATTTCCCTGGGATCTATACTCGAGTATAGATCCCAGGGAAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006710
VALIDATED
COPS8 MISSION shRNA shRNA Plasmid DNA
COP9 signalosome subunit 8
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006710.4-659s1c1
Sequence:CCGGGCTCCATAATGACATGAATAACTCGAGTTATTCATGTCATTATGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007619    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006710.4-1644s1c1
Sequence:CCGGCCACTAATGTAAGATACAGAACTCGAGTTCTGTATCTTACATTAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006710.4-1037s1c1
Sequence:CCGGCCTGGATGTTTCCTTTAACAACTCGAGTTGTTAAAGGAAACATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006710.4-831s1c1
Sequence:CCGGCAGCCAATTATGGAAGCACTTCTCGAGAAGTGCTTCCATAATTGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006710.4-954s1c1
Sequence:CCGGGCTGTGAAAGGCATATTAGAACTCGAGTTCTAATATGCCTTTCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006710.4-954s21c1
Sequence:CCGGGCTGTGAAAGGCATATTAGAACTCGAGTTCTAATATGCCTTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315149    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006710.4-1644s21c1
Sequence:CCGGCCACTAATGTAAGATACAGAACTCGAGTTCTGTATCTTACATTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006710.4-1113s21c1
Sequence:CCGGTTAGCCAGACTGACGGATTATCTCGAGATAATCCGTCAGTCTGGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006710.4-1037s21c1
Sequence:CCGGCCTGGATGTTTCCTTTAACAACTCGAGTTGTTAAAGGAAACATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006710.4-775s21c1
Sequence:CCGGGAGATTTCCCTGGGATCTATACTCGAGTATAGATCCCAGGGAAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006710
VALIDATED
COPS8 MISSION shRNA Lentiviral Transduction Particles
COP9 signalosome subunit 8
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006710.4-659s1c1
Sequence:CCGGGCTCCATAATGACATGAATAACTCGAGTTATTCATGTCATTATGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007619    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006710.4-1644s1c1
Sequence:CCGGCCACTAATGTAAGATACAGAACTCGAGTTCTGTATCTTACATTAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006710.4-1037s1c1
Sequence:CCGGCCTGGATGTTTCCTTTAACAACTCGAGTTGTTAAAGGAAACATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006710.4-831s1c1
Sequence:CCGGCAGCCAATTATGGAAGCACTTCTCGAGAAGTGCTTCCATAATTGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006710.4-954s1c1
Sequence:CCGGGCTGTGAAAGGCATATTAGAACTCGAGTTCTAATATGCCTTTCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006710.4-954s21c1
Sequence:CCGGGCTGTGAAAGGCATATTAGAACTCGAGTTCTAATATGCCTTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315149    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006710.4-1644s21c1
Sequence:CCGGCCACTAATGTAAGATACAGAACTCGAGTTCTGTATCTTACATTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006710.4-1113s21c1
Sequence:CCGGTTAGCCAGACTGACGGATTATCTCGAGATAATCCGTCAGTCTGGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006710.4-1037s21c1
Sequence:CCGGCCTGGATGTTTCCTTTAACAACTCGAGTTGTTAAAGGAAACATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006710.4-775s21c1
Sequence:CCGGGAGATTTCCCTGGGATCTATACTCGAGTATAGATCCCAGGGAAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133805
VALIDATED
COPS8 MISSION shRNA Bacterial Glycerol Stock
COP9 signalosome subunit 8
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000176025    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133805.2-1662s1c1
Sequence:CCGGGCAGTGATGTAGCATCAGAAACTCGAGTTTCTGATGCTACATCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133805.2-722s1c1
Sequence:CCGGCTCCAGAACGACATGAATAATCTCGAGATTATTCATGTCGTTCTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133805.2-616s1c1
Sequence:CCGGCTTCAGTTTCAGAAAGCTGTTCTCGAGAACAGCTTTCTGAAACTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133805.2-770s1c1
Sequence:CCGGCCTGCTATAAAGTCTGCAAATCTCGAGATTTGCAGACTTTATAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133805
VALIDATED
COPS8 MISSION shRNA shRNA Plasmid DNA
COP9 signalosome subunit 8
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000176025    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133805.2-1662s1c1
Sequence:CCGGGCAGTGATGTAGCATCAGAAACTCGAGTTTCTGATGCTACATCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133805.2-722s1c1
Sequence:CCGGCTCCAGAACGACATGAATAATCTCGAGATTATTCATGTCGTTCTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133805.2-616s1c1
Sequence:CCGGCTTCAGTTTCAGAAAGCTGTTCTCGAGAACAGCTTTCTGAAACTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133805.2-770s1c1
Sequence:CCGGCCTGCTATAAAGTCTGCAAATCTCGAGATTTGCAGACTTTATAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133805
VALIDATED
COPS8 MISSION shRNA Lentiviral Transduction Particles
COP9 signalosome subunit 8
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000176025    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133805.2-1662s1c1
Sequence:CCGGGCAGTGATGTAGCATCAGAAACTCGAGTTTCTGATGCTACATCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133805.2-722s1c1
Sequence:CCGGCTCCAGAACGACATGAATAATCTCGAGATTATTCATGTCGTTCTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133805.2-616s1c1
Sequence:CCGGCTTCAGTTTCAGAAAGCTGTTCTCGAGAACAGCTTTCTGAAACTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133805.2-770s1c1
Sequence:CCGGCCTGCTATAAAGTCTGCAAATCTCGAGATTTGCAGACTTTATAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks