EMAIL THIS PAGE TO A FRIEND

COPZ1

coatomer protein complex, subunit zeta 1

134 Gene Product Result for
Synonyms: COPZ HSPC181 zeta-COP zeta1-COP
UniProtKB ID: P61923, Q549N6, Q9Y3C3
Gene ID:
Human(22818) Summary: This gene encodes a subunit of the cytoplasmic coatamer protein complex, which is involved in autophagy and intracellular protein trafficking. The coatomer protein complex is comprised of seven subunits and functions as the coat protein of coat protein complex (COP)I-vesicles. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Mouse(56447) coatomer protein complex, subunit zeta 1
Rat(315345) coatomer protein complex, subunit zeta 1
Zebrafish(57970) coatomer protein complex, subunit zeta 1
dog(607013) coatomer protein complex, subunit zeta 1
domestic cat(101092620) coatomer protein complex, subunit zeta 1
cow(281707) coatomer protein complex, subunit zeta 1
domestic guinea pig(100723756) coatomer protein complex, subunit zeta 1
naked mole-rat(101712626) coatomer protein complex, subunit zeta 1
sheep(101119708) coatomer protein complex, subunit zeta 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016057 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016057 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016057 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019817 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019817 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019817 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016057 Rosetta Predictions human pricing
NM_001108117 Rosetta Predictions rat pricing
NM_019817 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016057 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214937 predicted 389
2 SASI_Hs01_00214939 predicted 810
3 SASI_Hs01_00214940 predicted 885
4 SASI_Hs01_00214941 predicted 555
5 SASI_Hs01_00214942 predicted 199
6 SASI_Hs01_00214943 predicted 459
7 SASI_Hs01_00214944 predicted 898
8 SASI_Hs01_00214945 predicted 462
9 SASI_Hs01_00214946 predicted 881
10 SASI_Hs01_00214938 predicted 899
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108117 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235524 predicted 256
2 SASI_Rn02_00235525 predicted 255
3 SASI_Rn02_00235526 predicted 205
4 SASI_Rn02_00235527 predicted 562
5 SASI_Rn02_00235528 predicted 520
6 SASI_Rn02_00235529 predicted 197
7 SASI_Rn02_00235530 predicted 459
8 SASI_Rn02_00235531 predicted 557
9 SASI_Rn02_00235532 predicted 542
10 SASI_Rn02_00235533 predicted 1049
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019817 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114391 predicted 986
2 SASI_Mm02_00325096 predicted 1026
3 SASI_Mm01_00114392 predicted 1013
4 SASI_Mm01_00114393 predicted 795
5 SASI_Mm01_00114394 predicted 214
6 SASI_Mm01_00114395 predicted 784
7 SASI_Mm02_00325097 predicted 772
8 SASI_Mm01_00114398 predicted 621
9 SASI_Mm01_00114399 predicted 871
10 SASI_Mm01_00114400 predicted 213
11 SASI_Mm01_00114396 predicted 571
12 SASI_Mm01_00114397 predicted 1012
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016057
VALIDATED
COPZ1 MISSION shRNA Bacterial Glycerol Stock
coatomer protein complex, subunit zeta 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381033    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016057.1-848s21c1
Sequence:GTACCGGTGCTCCCTTGCCCTGACATTTCTCGAGAAATGTCAGGGCAAGGGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380555    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016057.1-892s21c1
Sequence:GTACCGGGTAGCTACACTTCAGATTAAACTCGAGTTTAATCTGAAGTGTAGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016057.1-64s21c1
Sequence:CCGGCCTGTATACTGTCAAAGCCATCTCGAGATGGCTTTGACAGTATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016057.1-193s21c1
Sequence:CCGGCCATCGGACTGACAGTGAAATCTCGAGATTTCACTGTCAGTCCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016057.1-249s21c1
Sequence:CCGGGCAGTATAGATCTCTATTTCTCTCGAGAGAAATAGAGATCTATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016057.1-532s21c1
Sequence:CCGGGTCAGCCAAAGAACAGATCAACTCGAGTTGATCTGTTCTTTGGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016057.1-328s21c1
Sequence:CCGGCTTCGACTCATTGAGCCAGATCTCGAGATCTGGCTCAATGAGTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379566    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016057.1-773s21c1
Sequence:GTACCGGGTAAAGCTCCCAGCATATTTACTCGAGTAAATATGCTGGGAGCTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016057.1-193s1c1
Sequence:CCGGCCATCGGACTGACAGTGAAATCTCGAGATTTCACTGTCAGTCCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016057.1-328s1c1
Sequence:CCGGCTTCGACTCATTGAGCCAGATCTCGAGATCTGGCTCAATGAGTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016057.1-249s1c1
Sequence:CCGGGCAGTATAGATCTCTATTTCTCTCGAGAGAAATAGAGATCTATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016057.1-532s1c1
Sequence:CCGGGTCAGCCAAAGAACAGATCAACTCGAGTTGATCTGTTCTTTGGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_016057.1-64s1c1
Sequence:CCGGCCTGTATACTGTCAAAGCCATCTCGAGATGGCTTTGACAGTATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016057
VALIDATED
COPZ1 MISSION shRNA shRNA Plasmid DNA
coatomer protein complex, subunit zeta 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381033    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016057.1-848s21c1
Sequence:GTACCGGTGCTCCCTTGCCCTGACATTTCTCGAGAAATGTCAGGGCAAGGGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380555    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016057.1-892s21c1
Sequence:GTACCGGGTAGCTACACTTCAGATTAAACTCGAGTTTAATCTGAAGTGTAGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016057.1-64s21c1
Sequence:CCGGCCTGTATACTGTCAAAGCCATCTCGAGATGGCTTTGACAGTATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016057.1-193s21c1
Sequence:CCGGCCATCGGACTGACAGTGAAATCTCGAGATTTCACTGTCAGTCCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016057.1-249s21c1
Sequence:CCGGGCAGTATAGATCTCTATTTCTCTCGAGAGAAATAGAGATCTATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016057.1-532s21c1
Sequence:CCGGGTCAGCCAAAGAACAGATCAACTCGAGTTGATCTGTTCTTTGGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016057.1-328s21c1
Sequence:CCGGCTTCGACTCATTGAGCCAGATCTCGAGATCTGGCTCAATGAGTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379566    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016057.1-773s21c1
Sequence:GTACCGGGTAAAGCTCCCAGCATATTTACTCGAGTAAATATGCTGGGAGCTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016057.1-193s1c1
Sequence:CCGGCCATCGGACTGACAGTGAAATCTCGAGATTTCACTGTCAGTCCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016057.1-328s1c1
Sequence:CCGGCTTCGACTCATTGAGCCAGATCTCGAGATCTGGCTCAATGAGTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016057.1-249s1c1
Sequence:CCGGGCAGTATAGATCTCTATTTCTCTCGAGAGAAATAGAGATCTATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016057.1-532s1c1
Sequence:CCGGGTCAGCCAAAGAACAGATCAACTCGAGTTGATCTGTTCTTTGGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_016057.1-64s1c1
Sequence:CCGGCCTGTATACTGTCAAAGCCATCTCGAGATGGCTTTGACAGTATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016057
VALIDATED
COPZ1 MISSION shRNA Lentiviral Transduction Particles
coatomer protein complex, subunit zeta 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381033    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016057.1-848s21c1
Sequence:GTACCGGTGCTCCCTTGCCCTGACATTTCTCGAGAAATGTCAGGGCAAGGGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380555    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016057.1-892s21c1
Sequence:GTACCGGGTAGCTACACTTCAGATTAAACTCGAGTTTAATCTGAAGTGTAGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016057.1-64s21c1
Sequence:CCGGCCTGTATACTGTCAAAGCCATCTCGAGATGGCTTTGACAGTATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016057.1-193s21c1
Sequence:CCGGCCATCGGACTGACAGTGAAATCTCGAGATTTCACTGTCAGTCCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016057.1-249s21c1
Sequence:CCGGGCAGTATAGATCTCTATTTCTCTCGAGAGAAATAGAGATCTATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016057.1-532s21c1
Sequence:CCGGGTCAGCCAAAGAACAGATCAACTCGAGTTGATCTGTTCTTTGGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016057.1-328s21c1
Sequence:CCGGCTTCGACTCATTGAGCCAGATCTCGAGATCTGGCTCAATGAGTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379566    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016057.1-773s21c1
Sequence:GTACCGGGTAAAGCTCCCAGCATATTTACTCGAGTAAATATGCTGGGAGCTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016057.1-193s1c1
Sequence:CCGGCCATCGGACTGACAGTGAAATCTCGAGATTTCACTGTCAGTCCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016057.1-328s1c1
Sequence:CCGGCTTCGACTCATTGAGCCAGATCTCGAGATCTGGCTCAATGAGTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016057.1-249s1c1
Sequence:CCGGGCAGTATAGATCTCTATTTCTCTCGAGAGAAATAGAGATCTATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016057.1-532s1c1
Sequence:CCGGGTCAGCCAAAGAACAGATCAACTCGAGTTGATCTGTTCTTTGGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_016057.1-64s1c1
Sequence:CCGGCCTGTATACTGTCAAAGCCATCTCGAGATGGCTTTGACAGTATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019817
VALIDATED
COPZ1 MISSION shRNA Bacterial Glycerol Stock
coatomer protein complex, subunit zeta 1
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019817.1-195s21c1
Sequence:CCGGAGGATTGACAGTGGTCTATAACTCGAGTTATAGACCACTGTCAATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019817.1-504s21c1
Sequence:CCGGAGCCAAAGAACAGATCAAGTGCTCGAGCACTTGATCTGTTCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019817.1-283s21c1
Sequence:CCGGGTTCTGAACTGCCTCTTCGATCTCGAGATCGAAGAGGCAGTTCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019817.1-170s21c1
Sequence:CCGGCGGATAGTGAAATCGCTCTGTCTCGAGACAGAGCGATTTCACTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019817.1-781s21c1
Sequence:CCGGCCTTGGTTTCTTGGCCCTTTACTCGAGTAAAGGGCCAAGAAACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019817.1-49s21c1
Sequence:CCGGGCCATCCTGATTCTGGACAATCTCGAGATTGTCCAGAATCAGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019817.1-80s21c1
Sequence:CCGGGACTCTTCGCCAAGTACTATGCTCGAGCATAGTACTTGGCGAAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100680    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019817.1-781s1c1
Sequence:CCGGCCTTGGTTTCTTGGCCCTTTACTCGAGTAAAGGGCCAAGAAACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019817.1-283s1c1
Sequence:CCGGGTTCTGAACTGCCTCTTCGATCTCGAGATCGAAGAGGCAGTTCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019817.1-170s1c1
Sequence:CCGGCGGATAGTGAAATCGCTCTGTCTCGAGACAGAGCGATTTCACTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019817.1-225s1c1
Sequence:CCGGCGATCTCTATTTCTATGTGATCTCGAGATCACATAGAAATAGAGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019817.1-49s1c1
Sequence:CCGGGCCATCCTGATTCTGGACAATCTCGAGATTGTCCAGAATCAGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019817
VALIDATED
COPZ1 MISSION shRNA shRNA Plasmid DNA
coatomer protein complex, subunit zeta 1
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019817.1-195s21c1
Sequence:CCGGAGGATTGACAGTGGTCTATAACTCGAGTTATAGACCACTGTCAATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019817.1-504s21c1
Sequence:CCGGAGCCAAAGAACAGATCAAGTGCTCGAGCACTTGATCTGTTCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019817.1-283s21c1
Sequence:CCGGGTTCTGAACTGCCTCTTCGATCTCGAGATCGAAGAGGCAGTTCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019817.1-170s21c1
Sequence:CCGGCGGATAGTGAAATCGCTCTGTCTCGAGACAGAGCGATTTCACTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019817.1-781s21c1
Sequence:CCGGCCTTGGTTTCTTGGCCCTTTACTCGAGTAAAGGGCCAAGAAACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019817.1-49s21c1
Sequence:CCGGGCCATCCTGATTCTGGACAATCTCGAGATTGTCCAGAATCAGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019817.1-80s21c1
Sequence:CCGGGACTCTTCGCCAAGTACTATGCTCGAGCATAGTACTTGGCGAAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100680    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019817.1-781s1c1
Sequence:CCGGCCTTGGTTTCTTGGCCCTTTACTCGAGTAAAGGGCCAAGAAACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019817.1-283s1c1
Sequence:CCGGGTTCTGAACTGCCTCTTCGATCTCGAGATCGAAGAGGCAGTTCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019817.1-170s1c1
Sequence:CCGGCGGATAGTGAAATCGCTCTGTCTCGAGACAGAGCGATTTCACTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019817.1-225s1c1
Sequence:CCGGCGATCTCTATTTCTATGTGATCTCGAGATCACATAGAAATAGAGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019817.1-49s1c1
Sequence:CCGGGCCATCCTGATTCTGGACAATCTCGAGATTGTCCAGAATCAGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019817
VALIDATED
COPZ1 MISSION shRNA Lentiviral Transduction Particles
coatomer protein complex, subunit zeta 1
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019817.1-195s21c1
Sequence:CCGGAGGATTGACAGTGGTCTATAACTCGAGTTATAGACCACTGTCAATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019817.1-504s21c1
Sequence:CCGGAGCCAAAGAACAGATCAAGTGCTCGAGCACTTGATCTGTTCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019817.1-283s21c1
Sequence:CCGGGTTCTGAACTGCCTCTTCGATCTCGAGATCGAAGAGGCAGTTCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019817.1-170s21c1
Sequence:CCGGCGGATAGTGAAATCGCTCTGTCTCGAGACAGAGCGATTTCACTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019817.1-781s21c1
Sequence:CCGGCCTTGGTTTCTTGGCCCTTTACTCGAGTAAAGGGCCAAGAAACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019817.1-49s21c1
Sequence:CCGGGCCATCCTGATTCTGGACAATCTCGAGATTGTCCAGAATCAGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019817.1-80s21c1
Sequence:CCGGGACTCTTCGCCAAGTACTATGCTCGAGCATAGTACTTGGCGAAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100680    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019817.1-781s1c1
Sequence:CCGGCCTTGGTTTCTTGGCCCTTTACTCGAGTAAAGGGCCAAGAAACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019817.1-283s1c1
Sequence:CCGGGTTCTGAACTGCCTCTTCGATCTCGAGATCGAAGAGGCAGTTCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019817.1-170s1c1
Sequence:CCGGCGGATAGTGAAATCGCTCTGTCTCGAGACAGAGCGATTTCACTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019817.1-225s1c1
Sequence:CCGGCGATCTCTATTTCTATGTGATCTCGAGATCACATAGAAATAGAGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019817.1-49s1c1
Sequence:CCGGGCCATCCTGATTCTGGACAATCTCGAGATTGTCCAGAATCAGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks