EMAIL THIS PAGE TO A FRIEND

COPZ2

coatomer protein complex, subunit zeta 2

48 Gene Product Result for
UniProtKB ID: Q9P299
Gene ID:
Human(51226) Summary: This gene encodes a subunit of the coatomer protein complex, a seven-subunit complex that functions in the formation of COPI-type, non-clathrin-coated vesicles. COPI vesicles function in the retrograde Golgi-to-ER transport of dilysine-tagged proteins. This gene is similar to a related family member, and the two encoded proteins form distinct isotypes of the coatomer protein complex. [provided by RefSeq, Jul 2008]
Mouse(56358) coatomer protein complex, subunit zeta 2
Rat(360611) coatomer protein complex, subunit zeta 2
sheep(101122121) coatomer protein complex, subunit zeta 2
naked mole-rat(101703086) coatomer protein complex, subunit zeta 2
domestic guinea pig(100717538) coatomer protein complex, subunit zeta 2
Zebrafish(57969) zeta2-cop
dog(491050) coatomer protein complex, subunit zeta 2
cow(616222) coatomer protein complex, subunit zeta 2
domestic cat(101096858) coatomer protein complex, subunit zeta 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016429 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016429 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016429 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019877 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019877 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019877 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016429 Rosetta Predictions human pricing
NM_001108294 Rosetta Predictions rat pricing
NM_019877 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016429 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226341 predicted 364
2 SASI_Hs01_00226342 predicted 295
3 SASI_Hs01_00226343 predicted 408
4 SASI_Hs01_00226344 predicted 617
5 SASI_Hs02_00349454 predicted 344
6 SASI_Hs01_00226345 predicted 362
7 SASI_Hs01_00226346 predicted 604
8 SASI_Hs01_00226347 predicted 580
9 SASI_Hs01_00226348 predicted 551
10 SASI_Hs02_00349455 predicted 630
11 SASI_Hs01_00226340 predicted 400
12 SASI_Hs01_00226349 predicted 510
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108294 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237239 predicted 311
2 SASI_Rn02_00237240 predicted 259
3 SASI_Rn02_00237241 predicted 282
4 SASI_Rn02_00237242 predicted 311
5 SASI_Rn02_00237243 predicted 331
6 SASI_Rn02_00237244 predicted 519
7 SASI_Rn02_00237245 predicted 395
8 SASI_Rn02_00237246 predicted 600
9 SASI_Rn02_00237247 predicted 591
10 SASI_Rn02_00237248 predicted 661
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019877 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187762 predicted 347
2 SASI_Mm01_00187763 predicted 265
3 SASI_Mm01_00187764 predicted 516
4 SASI_Mm01_00187765 predicted 574
5 SASI_Mm02_00325180 predicted 621
6 SASI_Mm01_00187767 predicted 292
7 SASI_Mm01_00187768 predicted 340
8 SASI_Mm01_00187769 predicted 602
9 SASI_Mm01_00187770 predicted 544
10 SASI_Mm02_00325181 predicted 616
11 SASI_Mm01_00187766 predicted 206
12 SASI_Mm01_00187771 predicted 327
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016429
VALIDATED
COPZ2 MISSION shRNA Bacterial Glycerol Stock
coatomer protein complex, subunit zeta 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016429.1-195s1c1
Sequence:CCGGCCAAGTATTATGATGACACATCTCGAGATGTGTCATCATAATACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016429.1-424s1c1
Sequence:CCGGGTTAAGGAAGAACGTGGAGAACTCGAGTTCTCCACGTTCTTCCTTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016429.1-532s1c1
Sequence:CCGGGCAAGTGATCCAGAAGGTGAACTCGAGTTCACCTTCTGGATCACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016429.1-407s1c1
Sequence:CCGGGAGTCTCTGAACCACATGTTACTCGAGTAACATGTGGTTCAGAGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016429.1-608s1c1
Sequence:CCGGTCTGCCAAGGAACAAATTAAACTCGAGTTTAATTTGTTCCTTGGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016429.2-408s21c1
Sequence:GTACCGGAGTCTCTGAACCACATGTTAACTCGAGTTAACATGTGGTTCAGAGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016429.2-477s21c1
Sequence:GTACCGGTCTTGGTGCTGGACGAGATTGCTCGAGCAATCTCGTCCAGCACCAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016429.2-301s21c1
Sequence:GTACCGGGGGTATGACCATCGTCTACAACTCGAGTTGTAGACGATGGTCATACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016429.2-131s21c1
Sequence:GTACCGGGAACCTTCCCTCTACACCATCCTCGAGGATGGTGTAGAGGGAAGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016429.2-535s21c1
Sequence:GTACCGGAGTGATCCAGAAGGTGAATTTCTCGAGAAATTCACCTTCTGGATCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016429
VALIDATED
COPZ2 MISSION shRNA shRNA Plasmid DNA
coatomer protein complex, subunit zeta 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016429.1-195s1c1
Sequence:CCGGCCAAGTATTATGATGACACATCTCGAGATGTGTCATCATAATACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016429.1-424s1c1
Sequence:CCGGGTTAAGGAAGAACGTGGAGAACTCGAGTTCTCCACGTTCTTCCTTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016429.1-532s1c1
Sequence:CCGGGCAAGTGATCCAGAAGGTGAACTCGAGTTCACCTTCTGGATCACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016429.1-407s1c1
Sequence:CCGGGAGTCTCTGAACCACATGTTACTCGAGTAACATGTGGTTCAGAGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016429.1-608s1c1
Sequence:CCGGTCTGCCAAGGAACAAATTAAACTCGAGTTTAATTTGTTCCTTGGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016429.2-408s21c1
Sequence:GTACCGGAGTCTCTGAACCACATGTTAACTCGAGTTAACATGTGGTTCAGAGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016429.2-477s21c1
Sequence:GTACCGGTCTTGGTGCTGGACGAGATTGCTCGAGCAATCTCGTCCAGCACCAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016429.2-301s21c1
Sequence:GTACCGGGGGTATGACCATCGTCTACAACTCGAGTTGTAGACGATGGTCATACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016429.2-131s21c1
Sequence:GTACCGGGAACCTTCCCTCTACACCATCCTCGAGGATGGTGTAGAGGGAAGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016429.2-535s21c1
Sequence:GTACCGGAGTGATCCAGAAGGTGAATTTCTCGAGAAATTCACCTTCTGGATCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016429
VALIDATED
COPZ2 MISSION shRNA Lentiviral Transduction Particles
coatomer protein complex, subunit zeta 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016429.1-195s1c1
Sequence:CCGGCCAAGTATTATGATGACACATCTCGAGATGTGTCATCATAATACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016429.1-424s1c1
Sequence:CCGGGTTAAGGAAGAACGTGGAGAACTCGAGTTCTCCACGTTCTTCCTTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016429.1-532s1c1
Sequence:CCGGGCAAGTGATCCAGAAGGTGAACTCGAGTTCACCTTCTGGATCACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016429.1-407s1c1
Sequence:CCGGGAGTCTCTGAACCACATGTTACTCGAGTAACATGTGGTTCAGAGACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016429.1-608s1c1
Sequence:CCGGTCTGCCAAGGAACAAATTAAACTCGAGTTTAATTTGTTCCTTGGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016429.2-408s21c1
Sequence:GTACCGGAGTCTCTGAACCACATGTTAACTCGAGTTAACATGTGGTTCAGAGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016429.2-477s21c1
Sequence:GTACCGGTCTTGGTGCTGGACGAGATTGCTCGAGCAATCTCGTCCAGCACCAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016429.2-301s21c1
Sequence:GTACCGGGGGTATGACCATCGTCTACAACTCGAGTTGTAGACGATGGTCATACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016429.2-131s21c1
Sequence:GTACCGGGAACCTTCCCTCTACACCATCCTCGAGGATGGTGTAGAGGGAAGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016429.2-535s21c1
Sequence:GTACCGGAGTGATCCAGAAGGTGAATTTCTCGAGAAATTCACCTTCTGGATCACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019877
VALIDATED
COPZ2 MISSION shRNA Bacterial Glycerol Stock
coatomer protein complex, subunit zeta 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100690    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019877.1-773s1c1
Sequence:CCGGCCAGGGATTCTGAGACGCAAACTCGAGTTTGCGTCTCAGAATCCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019877.1-611s1c1
Sequence:CCGGGAACAGATTAAATGGTCGCTACTCGAGTAGCGACCATTTAATCTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019877.1-149s1c1
Sequence:CCGGGCTGTCTTCATCTTAGATAATCTCGAGATTATCTAAGATGAAGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019877.1-159s1c1
Sequence:CCGGTCTTAGATAATGACGGGCGAACTCGAGTTCGCCCGTCATTATCTAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019877.1-526s1c1
Sequence:CCGGGCAAGTGATCCAGAAAGTGAACTCGAGTTCACTTTCTGGATCACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325450    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019877.2-770s21c1
Sequence:CCGGCCAGGGATTCTGAGACGCAAACTCGAGTTTGCGTCTCAGAATCCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019877.2-523s21c1
Sequence:CCGGGCAAGTGATCCAGAAAGTGAACTCGAGTTCACTTTCTGGATCACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019877.2-608s21c1
Sequence:CCGGGAACAGATTAAATGGTCGCTACTCGAGTAGCGACCATTTAATCTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019877.2-156s21c1
Sequence:CCGGTCTTAGATAATGACGGGCGAACTCGAGTTCGCCCGTCATTATCTAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019877.2-146s21c1
Sequence:CCGGGCTGTCTTCATCTTAGATAATCTCGAGATTATCTAAGATGAAGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019877
VALIDATED
COPZ2 MISSION shRNA shRNA Plasmid DNA
coatomer protein complex, subunit zeta 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100690    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019877.1-773s1c1
Sequence:CCGGCCAGGGATTCTGAGACGCAAACTCGAGTTTGCGTCTCAGAATCCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019877.1-611s1c1
Sequence:CCGGGAACAGATTAAATGGTCGCTACTCGAGTAGCGACCATTTAATCTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019877.1-149s1c1
Sequence:CCGGGCTGTCTTCATCTTAGATAATCTCGAGATTATCTAAGATGAAGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019877.1-159s1c1
Sequence:CCGGTCTTAGATAATGACGGGCGAACTCGAGTTCGCCCGTCATTATCTAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019877.1-526s1c1
Sequence:CCGGGCAAGTGATCCAGAAAGTGAACTCGAGTTCACTTTCTGGATCACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325450    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019877.2-770s21c1
Sequence:CCGGCCAGGGATTCTGAGACGCAAACTCGAGTTTGCGTCTCAGAATCCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019877.2-523s21c1
Sequence:CCGGGCAAGTGATCCAGAAAGTGAACTCGAGTTCACTTTCTGGATCACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019877.2-608s21c1
Sequence:CCGGGAACAGATTAAATGGTCGCTACTCGAGTAGCGACCATTTAATCTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000354047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019877.2-156s21c1
Sequence:CCGGTCTTAGATAATGACGGGCGAACTCGAGTTCGCCCGTCATTATCTAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019877.2-146s21c1
Sequence:CCGGGCTGTCTTCATCTTAGATAATCTCGAGATTATCTAAGATGAAGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019877
VALIDATED
COPZ2 MISSION shRNA Lentiviral Transduction Particles
coatomer protein complex, subunit zeta 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100690    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019877.1-773s1c1
Sequence:CCGGCCAGGGATTCTGAGACGCAAACTCGAGTTTGCGTCTCAGAATCCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019877.1-611s1c1
Sequence:CCGGGAACAGATTAAATGGTCGCTACTCGAGTAGCGACCATTTAATCTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019877.1-149s1c1
Sequence:CCGGGCTGTCTTCATCTTAGATAATCTCGAGATTATCTAAGATGAAGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019877.1-159s1c1
Sequence:CCGGTCTTAGATAATGACGGGCGAACTCGAGTTCGCCCGTCATTATCTAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019877.1-526s1c1
Sequence:CCGGGCAAGTGATCCAGAAAGTGAACTCGAGTTCACTTTCTGGATCACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325450    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019877.2-770s21c1
Sequence:CCGGCCAGGGATTCTGAGACGCAAACTCGAGTTTGCGTCTCAGAATCCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019877.2-523s21c1
Sequence:CCGGGCAAGTGATCCAGAAAGTGAACTCGAGTTCACTTTCTGGATCACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019877.2-608s21c1
Sequence:CCGGGAACAGATTAAATGGTCGCTACTCGAGTAGCGACCATTTAATCTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019877.2-156s21c1
Sequence:CCGGTCTTAGATAATGACGGGCGAACTCGAGTTCGCCCGTCATTATCTAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019877.2-146s21c1
Sequence:CCGGGCTGTCTTCATCTTAGATAATCTCGAGATTATCTAAGATGAAGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)