EMAIL THIS PAGE TO A FRIEND

COQ10A

coenzyme Q10 homolog A (S. cerevisiae)

Gene ID:
Mouse(210582) coenzyme Q10 homolog A (yeast)
Rat(362810) coenzyme Q10 homolog A (S. cerevisiae)
chicken(770970) coenzyme Q10 homolog A (S. cerevisiae)
domestic cat(101097817) coenzyme Q10 homolog A (S. cerevisiae)
cow(538821) coenzyme Q10 homolog A (S. cerevisiae)
dog(474402) coenzyme Q10 homolog A (S. cerevisiae)
domestic guinea pig(100733723) coenzyme Q10 homolog A (S. cerevisiae)
naked mole-rat(101710521) coenzyme Q10 homolog A (S. cerevisiae)
sheep(101102384) coenzyme Q10 homolog A (S. cerevisiae)
164 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA068931 Anti-COQ10A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081040 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081040 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081040 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144576 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144576 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144576 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099337 Rosetta Predictions human pricing
NM_144576 Rosetta Predictions human pricing
NM_001108727 Rosetta Predictions rat pricing
NM_001081040 Rosetta Predictions mouse pricing
XM_001004829 Rosetta Predictions mouse pricing
XM_109592 Rosetta Predictions mouse pricing
XM_892360 Rosetta Predictions mouse pricing
XM_900079 Rosetta Predictions mouse pricing
XM_900081 Rosetta Predictions mouse pricing
XM_900085 Rosetta Predictions mouse pricing
XM_900090 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099337 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320499 predicted 895
2 SASI_Hs02_00320500 predicted 526
3 SASI_Hs02_00320501 predicted 944
4 SASI_Hs02_00320502 predicted 1101
5 SASI_Hs02_00320503 predicted 1016
6 SASI_Hs02_00320504 predicted 1168
7 SASI_Hs02_00320505 predicted 1018
8 SASI_Hs02_00320506 predicted 510
9 SASI_Hs02_00320507 predicted 358
10 SASI_Hs02_00320508 predicted 982
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144576 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364358 predicted 1144
2 SASI_Hs01_00237678 predicted 769
3 SASI_Hs01_00237679 predicted 1189
4 SASI_Hs02_00364359 predicted 1352
5 SASI_Hs01_00237680 predicted 1252
6 SASI_Hs02_00364360 predicted 1417
7 SASI_Hs02_00364361 predicted 1264
8 SASI_Hs01_00237681 predicted 752
9 SASI_Hs01_00237682 predicted 608
10 SASI_Hs01_00237685 predicted 1225
11 SASI_Hs01_00237676 predicted 641
12 SASI_Hs01_00237677 predicted 421
13 SASI_Hs01_00237683 predicted 438
14 SASI_Hs01_00237684 predicted 1196
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108727 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241485 predicted 221
2 SASI_Rn02_00241486 predicted 869
3 SASI_Rn02_00241487 predicted 996
4 SASI_Rn02_00241488 predicted 853
5 SASI_Rn02_00241489 predicted 1000
6 SASI_Rn02_00241490 predicted 873
7 SASI_Rn02_00241491 predicted 1015
8 SASI_Rn02_00241492 predicted 280
9 SASI_Rn02_00241493 predicted 803
10 SASI_Rn02_00241494 predicted 981
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081040 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294591 predicted 1755
2 SASI_Mm02_00294592 predicted 1325
3 SASI_Mm02_00294593 predicted 1441
4 SASI_Mm02_00294594 predicted 1629
5 SASI_Mm02_00294595 predicted 2054
6 SASI_Mm02_00294596 predicted 1732
7 SASI_Mm02_00294597 predicted 2049
8 SASI_Mm02_00294598 predicted 1580
9 SASI_Mm02_00294599 predicted 1907
10 SASI_Mm02_00294600 predicted 1583
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004829 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00260346 predicted 1757
2 SASI_Mm01_00260347 predicted 1331
3 SASI_Mm01_00260348 predicted 1443
4 SASI_Mm01_00260349 predicted 1630
5 SASI_Mm01_00260350 predicted 2051
6 SASI_Mm01_00260351 predicted 1743
7 SASI_Mm01_00260352 predicted 1734
8 SASI_Mm01_00260353 predicted 1585
9 SASI_Mm01_00260354 predicted 1908
10 SASI_Mm01_00260355 predicted 1517
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_109592 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00226891 predicted 1723
2 SASI_Mm01_00226892 predicted 1338
3 SASI_Mm01_00226893 predicted 1598
4 SASI_Mm01_00226894 predicted 2028
5 SASI_Mm01_00226895 predicted 1716
6 SASI_Mm01_00226896 predicted 1493
7 SASI_Mm01_00226897 predicted 2029
8 SASI_Mm01_00226898 predicted 1555
9 SASI_Mm01_00226899 predicted 1888
10 SASI_Mm01_00226900 predicted 1553
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_892360 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00264801 predicted 568
2 SASI_Mm01_00264802 predicted 451
3 SASI_Mm01_00264803 predicted 873
4 SASI_Mm01_00264804 predicted 553
5 SASI_Mm01_00264805 predicted 333
6 SASI_Mm01_00264806 predicted 868
7 SASI_Mm01_00264807 predicted 395
8 SASI_Mm01_00264808 predicted 725
9 SASI_Mm01_00264809 predicted 406
10 SASI_Mm01_00264810 predicted 949
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900079 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00284830 predicted 1382
2 SASI_Mm01_00284831 predicted 1075
3 SASI_Mm01_00284832 predicted 1044
4 SASI_Mm01_00284833 predicted 980
5 SASI_Mm01_00284834 predicted 958
6 SASI_Mm01_00284835 predicted 1090
7 SASI_Mm01_00284836 predicted 1263
8 SASI_Mm01_00284837 predicted 1076
9 SASI_Mm01_00284838 predicted 1140
10 SASI_Mm01_00284839 predicted 1398
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900081 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00221878 predicted 994
2 SASI_Mm01_00221879 predicted 1037
3 SASI_Mm01_00221880 predicted 977
4 SASI_Mm01_00221881 predicted 952
5 SASI_Mm01_00221882 predicted 927
6 SASI_Mm01_00221883 predicted 926
7 SASI_Mm01_00221884 predicted 910
8 SASI_Mm01_00221885 predicted 1057
9 SASI_Mm01_00221886 predicted 979
10 SASI_Mm01_00221887 predicted 1024
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900085 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00263807 predicted 1644
2 SASI_Mm01_00263808 predicted 1936
3 SASI_Mm01_00263809 predicted 1688
4 SASI_Mm01_00263810 predicted 1329
5 SASI_Mm01_00263811 predicted 1450
6 SASI_Mm01_00263812 predicted 1336
7 SASI_Mm01_00263813 predicted 1527
8 SASI_Mm01_00263814 predicted 1813
9 SASI_Mm01_00263815 predicted 1615
10 SASI_Mm01_00263816 predicted 1674
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900090 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00268045 predicted 1236
2 SASI_Mm01_00268046 predicted 927
3 SASI_Mm01_00268047 predicted 896
4 SASI_Mm01_00268048 predicted 672
5 SASI_Mm01_00268049 predicted 828
6 SASI_Mm01_00268050 predicted 809
7 SASI_Mm01_00268051 predicted 931
8 SASI_Mm01_00268052 predicted 715
9 SASI_Mm01_00268053 predicted 928
10 SASI_Mm01_00268054 predicted 996
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081040
VALIDATED
COQ10A MISSION shRNA Bacterial Glycerol Stock
coenzyme Q10 homolog A (S. cerevisiae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081040.1-1737s21c1
Sequence:CCGGCAACCACTTAGAGACTATTTGCTCGAGCAAATAGTCTCTAAGTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081040.1-1587s21c1
Sequence:CCGGTAAGAAGTCACTGGTAGTATCCTCGAGGATACTACCAGTGACTTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081040.1-2179s21c1
Sequence:CCGGAGGCCGTTGCACACCAAATAACTCGAGTTATTTGGTGTGCAACGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081040.1-1507s21c1
Sequence:CCGGTCTTGCTGTAGGTACTCAATGCTCGAGCATTGAGTACCTACAGCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081040.1-1796s21c1
Sequence:CCGGGCACTGTGGACTTCTCGATTTCTCGAGAAATCGAGAAGTCCACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081040
VALIDATED
COQ10A MISSION shRNA shRNA Plasmid DNA
coenzyme Q10 homolog A (S. cerevisiae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081040.1-1737s21c1
Sequence:CCGGCAACCACTTAGAGACTATTTGCTCGAGCAAATAGTCTCTAAGTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081040.1-1587s21c1
Sequence:CCGGTAAGAAGTCACTGGTAGTATCCTCGAGGATACTACCAGTGACTTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081040.1-2179s21c1
Sequence:CCGGAGGCCGTTGCACACCAAATAACTCGAGTTATTTGGTGTGCAACGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081040.1-1507s21c1
Sequence:CCGGTCTTGCTGTAGGTACTCAATGCTCGAGCATTGAGTACCTACAGCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081040.1-1796s21c1
Sequence:CCGGGCACTGTGGACTTCTCGATTTCTCGAGAAATCGAGAAGTCCACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081040
VALIDATED
COQ10A MISSION shRNA Lentiviral Transduction Particles
coenzyme Q10 homolog A (S. cerevisiae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081040.1-1737s21c1
Sequence:CCGGCAACCACTTAGAGACTATTTGCTCGAGCAAATAGTCTCTAAGTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081040.1-1587s21c1
Sequence:CCGGTAAGAAGTCACTGGTAGTATCCTCGAGGATACTACCAGTGACTTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081040.1-2179s21c1
Sequence:CCGGAGGCCGTTGCACACCAAATAACTCGAGTTATTTGGTGTGCAACGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081040.1-1507s21c1
Sequence:CCGGTCTTGCTGTAGGTACTCAATGCTCGAGCATTGAGTACCTACAGCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081040.1-1796s21c1
Sequence:CCGGGCACTGTGGACTTCTCGATTTCTCGAGAAATCGAGAAGTCCACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144576
VALIDATED
COQ10A MISSION shRNA Bacterial Glycerol Stock
coenzyme Q10 homolog A (S. cerevisiae)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144576.3-469s21c1
Sequence:CCGGAGCCGTTCCTTCATGGGATTTCTCGAGAAATCCCATGAAGGAACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144576.3-781s21c1
Sequence:CCGGTGGCGATTCAGCCCTGGTATTCTCGAGAATACCAGGGCTGAATCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144576.3-1386s21c1
Sequence:CCGGAGGTACTGAGTGGTAAGTAACCTCGAGGTTACTTACCACTCAGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_144576.3-630s21c1
Sequence:CCGGATCCAGCCGTAAGGGTCATTTCTCGAGAAATGACCCTTACGGCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144576.2-417s1c1
Sequence:CCGGCACCAACAAGCGAAAGGCTTACTCGAGTAAGCCTTTCGCTTGTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144576.2-305s1c1
Sequence:CCGGCAATGAGGTTTCTGACCTCCTCTCGAGAGGAGGTCAGAAACCTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137900    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144576.2-1363s1c1
Sequence:CCGGGCCTCCAGCCTGAAATACATACTCGAGTATGTATTTCAGGCTGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144576.2-1371s1c1
Sequence:CCGGCCTGAAATACATAAAGCCTCACTCGAGTGAGGCTTTATGTATTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134742    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144576.2-1008s1c1
Sequence:CCGGGAAAGGAGTCTGTGTTCATAACTCGAGTTATGAACACAGACTCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_144576.2-675s1c1
Sequence:CCGGCTTCAACCACTTAGAGACTATCTCGAGATAGTCTCTAAGTGGTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_144576.2-808s1c1
Sequence:CCGGGATGAGGCTGTCAAACAGAATCTCGAGATTCTGTTTGACAGCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144576
VALIDATED
COQ10A MISSION shRNA shRNA Plasmid DNA
coenzyme Q10 homolog A (S. cerevisiae)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144576.3-469s21c1
Sequence:CCGGAGCCGTTCCTTCATGGGATTTCTCGAGAAATCCCATGAAGGAACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144576.3-781s21c1
Sequence:CCGGTGGCGATTCAGCCCTGGTATTCTCGAGAATACCAGGGCTGAATCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144576.3-1386s21c1
Sequence:CCGGAGGTACTGAGTGGTAAGTAACCTCGAGGTTACTTACCACTCAGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_144576.3-630s21c1
Sequence:CCGGATCCAGCCGTAAGGGTCATTTCTCGAGAAATGACCCTTACGGCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144576.2-417s1c1
Sequence:CCGGCACCAACAAGCGAAAGGCTTACTCGAGTAAGCCTTTCGCTTGTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144576.2-305s1c1
Sequence:CCGGCAATGAGGTTTCTGACCTCCTCTCGAGAGGAGGTCAGAAACCTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137900    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144576.2-1363s1c1
Sequence:CCGGGCCTCCAGCCTGAAATACATACTCGAGTATGTATTTCAGGCTGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144576.2-1371s1c1
Sequence:CCGGCCTGAAATACATAAAGCCTCACTCGAGTGAGGCTTTATGTATTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134742    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144576.2-1008s1c1
Sequence:CCGGGAAAGGAGTCTGTGTTCATAACTCGAGTTATGAACACAGACTCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_144576.2-675s1c1
Sequence:CCGGCTTCAACCACTTAGAGACTATCTCGAGATAGTCTCTAAGTGGTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_144576.2-808s1c1
Sequence:CCGGGATGAGGCTGTCAAACAGAATCTCGAGATTCTGTTTGACAGCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144576
VALIDATED
COQ10A MISSION shRNA Lentiviral Transduction Particles
coenzyme Q10 homolog A (S. cerevisiae)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144576.3-469s21c1
Sequence:CCGGAGCCGTTCCTTCATGGGATTTCTCGAGAAATCCCATGAAGGAACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144576.3-781s21c1
Sequence:CCGGTGGCGATTCAGCCCTGGTATTCTCGAGAATACCAGGGCTGAATCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144576.3-1386s21c1
Sequence:CCGGAGGTACTGAGTGGTAAGTAACCTCGAGGTTACTTACCACTCAGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_144576.3-630s21c1
Sequence:CCGGATCCAGCCGTAAGGGTCATTTCTCGAGAAATGACCCTTACGGCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144576.2-417s1c1
Sequence:CCGGCACCAACAAGCGAAAGGCTTACTCGAGTAAGCCTTTCGCTTGTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144576.2-305s1c1
Sequence:CCGGCAATGAGGTTTCTGACCTCCTCTCGAGAGGAGGTCAGAAACCTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137900    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144576.2-1363s1c1
Sequence:CCGGGCCTCCAGCCTGAAATACATACTCGAGTATGTATTTCAGGCTGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144576.2-1371s1c1
Sequence:CCGGCCTGAAATACATAAAGCCTCACTCGAGTGAGGCTTTATGTATTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134742    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144576.2-1008s1c1
Sequence:CCGGGAAAGGAGTCTGTGTTCATAACTCGAGTTATGAACACAGACTCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_144576.2-675s1c1
Sequence:CCGGCTTCAACCACTTAGAGACTATCTCGAGATAGTCTCTAAGTGGTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_144576.2-808s1c1
Sequence:CCGGGATGAGGCTGTCAAACAGAATCTCGAGATTCTGTTTGACAGCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks